E5: how to remove text to speech.......so that my ...

finnish _stub.sis.............1680bytes.
finnish-kimmo-stub.sis.............2028bytes
location:Z /system/install.....
plz provide me link for apps to remove this is unwanted for me
THANK for nokia team support..............
Solved!
Go to Solution.

No the apps won't harm your card if you download from Nokia store. But use the apps that you want the most. Don't overload your card because this may slow down your phone. Hope this helps you.
Nokia C7

Similar Messages

How to use text-to-speech so that my text messages are read to me in the car?

How to use text-to-speech so that my text messages are read to me in the car?

I have the same question but I have iPhone 5

How to remove text from .swf animation?

how to remove text from .swf animation? Can no find this text
in fla file. Flash 8.

exactly what 'text' are you referring to? text that you typed
on the Stage using the 'textTool'? simply select the text with the
'arrowTool' and hit delete.
If you are referring to a textField that you want to
eliminate after a certain amount of time, within your animation
sequence. first copy the text, create a new layer, paste the text
in place, then where you want to have the text 'disappear' insert a
'blank keyframe' at that point in the text layer.
OR place the textfield within a MC and remove it with code.
OR if the text is dynamic and you wish to use the position at a
later time, pass a value of null or and empty string to the field
at the point you wish. And there are other ways still. :) hope one
of these works for you.

How to remove a black border box that continously tabs to each field automatically till end of web page; restarts to top of page, cannot stop this box. Scroll bar cannot controlled with mouse, returns auto to top of scroll slide, never remaining at bottom

how to remove a black border box that continously tabs to each field automatically till end of web page; restarts to top of page, cannot stop this box. Scroll bar cannot be controlled with mouse, scroll bar returns automatically to the top of scroll slide every time I move the bar to the bottom of the scale. Also, there's a rectangular text box (with black background and white text) that is always on the desktop that emulates a typed text, HTML, or cmd function.

cjuan1morb4ulv wrote:
how to remove a black border box that continously tabs to each field automatically till end of web page; restarts to top of page, cannot stop this box. Scroll bar cannot be controlled with mouse, scroll bar returns automatically to the top of scroll slide every time I move the bar to the bottom of the scale. Also, there's a rectangular text box (with black background and white text) that is always on the desktop that emulates a typed text, HTML, or cmd function.
The first two problems (box cycling from element to element on page, scroll bar returning to top) can be caused by a stuck (or defective) Tab key on the keyboard. Such damage can be caused by a liquid spill; just one tiny droplet is enough to short a wafer switch under one key.
The last issue (black box, white text - sounds sorta like a debugger window) I haven't seen, but could be caused by something similar.
To check for that, try using a different keyboard. If you're using a wireless keyboard, turn it off and see if the oddities stop.

Is there a text to speech app that can read text books to me?

Is there a text to speech app that can read text books to me?

The Apple Support Communities are an international user to user technical support forum. As a man from Mexico, Spanish is my native tongue. I do not speak English very well, however, I do write in English with the aid of the Mac OS X spelling and grammar checks. I also live in a culture perhaps very very different from your own. When offering advice in the ASC, my comments are not meant to be anything more than helpful and certainly not to be taken as insults.
You don't need an app for that text to speech is biult into OS X.
http://osxdaily.com/2010/03/28/how-to-make-your-mac-talk-text-to-speech/

How to remove the old email address that was hacked from my iCloud account when iCloud won't let me?

How to remove the old email address that was hacked from my iCloud account when iCloud won't let me?
Pretty much the the email that I used (but didn't verify) to create my iCloud account was hacked and now I can't remove it from my iCloud account due to the iCloud password also being changed by the same person and the fact I had "Find my iPhone" app on my phone also??? I had to change my iTunes email as well but that was far easier so yeah :S.
Please help. I live in NZ, out in the country, so reception is rare and so is getting into the nearest town that has an Apple Store.
Thanks

If you truly change your existing Apple ID's email address to a new email address, follow these instructions: iOS 7: If you're asked for the password to your previous Apple ID when signing out of iCloud
If you created a whole new Apple Account because you couldn't access the old one after being hacked, you will need to contact the Apple Account Security Team. Apple ID: Contacting Apple for help with Apple ID account security

I am looking for a text to speech app that supports the Books App?

I am looking for a text to speech app that supports the Books App?

If Settings -> General -> Accessibility -> VoiceOver does not work, then it is unlikely iBooks will do text to speach on its own in the current version.
<http://www.apple.com/feedback>
I know that some competing services, Kindle, Nook, etc... are restricted in doing text to speach by the book publishers.
If this is text in a PDF (not an ebook), then maybe there is another app that can to text to speach on PDFs.
If it is published books that are of interest, there is Audible.com <http://www.audible.com/>
In theory it should be possible to use the Mac OS X Text to Speach facilities to convert a document into an audio file, and they sync that to the iPod Touch. I assume there is similar text to speach utilities for Windows systems.
I'm also guessing that there are web sites dedicated to assisting sight impaired individuals that might provide ideas for getting text to speach options for the iPod Touch.

How to remove text from photo only one layer?

How do I remove text from this photo? plz & ty
o I remove text from a photo?

Contact the person who took the photo and ask for a clean copy.
If you don't know the photographer, chances are good that your use of the photo would be a violation of copyright.

How to remove text from JTable ...........

AOA
How to remove the text from cells of JPanel. Just to refresh the GUI.
regards

How to provide meaningful subject?
The subject of this thread does not match what you are asking in the body.
To set the value of a cell in a JTable, you can simply call setValueAt().
Read the API to find the method parameters.

How to Remove Text From Strings ?

Hi,
The question I have is, in the String that I have Pasted below, how can I remove the first line (>gi|23821530|dbj||SEG_D10989S Bos taurus gene for endothelin receptor) and then use the remainder of the text to Post to a web server?
I have tried doing this with a Regex (Pattern P = Pattern.compile("(^>.*)");), I'm able to capture the first line of text, but am not sure how to remove it and then use the rest of the text to Post to the web server.
Any Help with this would be much appreciated
gi|23821530|dbj||SEG_D10989S Bos taurus gene for endothelin receptorGGGATCCCGAGCAAACTGCGGAGGCCACACTGTCAGGCATTCCCTCGGCGTTTCGTCAGAGCCAGACCCT
CCCGCTGCTGAAGGGAGGCGCGCTCTGCTCCCGGGCTGCCGGGAACCCAGCCGCGCGCCGGGGAAGGAGG
TCCCTGCCTGGTGCGTCCGGACCAAGAGGTAACCGTTCTGCTTGGTGTTTAATTCAAATCTGTGATTGAA
CCTTATCCTGGGGCTTCAGTTTGGATTACTTCTTAGGTTTGTTTTTGTTTGTTTGTTTGTTTTTTAACCT
GTAGCTACAGCAGATTAAAATGGGATTGGAGTGAAGGAGAGGGCTTGAGTGTCTGAAGTCACTCGAAGGG
GATAGAAACTTCCGAGTTAATCCAGATAGAGACTCTTCCAAATAGACCAAGTGGAGATGTCCGGGAGATT
TTCCGAGTCAGCCGGCTCAGTCCTGGGGTGTGTGTATGGGGGGTGGGGGCGGTGCCGAAGAGCGGAAGGA
AGGGGTCTGAAAGTCCAGACATGCGGCATCCGGGGTTGCTGTGGAGTCGAAAGCAGAGACTGGCGATGCC
CTTGATCTCTAACCTGCCTTGATTTGCCCCGTCCCCGCGCGCCCTTGGCCAGAACGAATACTGCTCCCTC
TGCGCACACCAGGAGCTCAAAGCTTTGCTTTGGACACCCGTCCTCTCCTCCCCGTCACACCCCTTCCAGG

String foo = "gi|23821530|dbj||SEG_D10989S Bos taurus
gene for endothelin receptor";
String totalString = "gi|23821530|dbj||SEG_D10989S Bos
taurus gene for endothelin receptor
GGGATCCCGAGCAAACTGCGGAGGCCACACTGTCAGGCATTCCCTCGGCGTTTCG
CAGAGCCAGACCCT
CCCGCTGCTGAAGGGAGGCGCGCTCTGCTCCCGGGCTGCCGGGAACCCAGCCGCG
GCCGGGGAAGGAGG
TCCCTGCCTGGTGCGTCCGGACCAAGAGGTAACCGTTCTGCTTGGTGTTTAATTC
AATCTGTGATTGAA
CCTTATCCTGGGGCTTCAGTTTGGATTACTTCTTAGGTTTGTTTTTGTTTGTTTG
TTGTTTTTTAACCT
GTAGCTACAGCAGATTAAAATGGGATTGGAGTGAAGGAGAGGGCTTGAGTGTCTG
AGTCACTCGAAGGG
GATAGAAACTTCCGAGTTAATCCAGATAGAGACTCTTCCAAATAGACCAAGTGGA
ATGTCCGGGAGATT
TTCCGAGTCAGCCGGCTCAGTCCTGGGGTGTGTGTATGGGGGGTGGGGGCGGTGC
GAAGAGCGGAAGGA
AGGGGTCTGAAAGTCCAGACATGCGGCATCCGGGGTTGCTGTGGAGTCGAAAGCA
AGACTGGCGATGCC
CTTGATCTCTAACCTGCCTTGATTTGCCCCGTCCCCGCGCGCCCTTGGCCAGAAC
AATACTGCTCCCTC
TGCGCACACCAGGAGCTCAAAGCTTTGCTTTGGACACCCGTCCTCTCCTCCCCGT
ACACCCCTTCCAGG";
int position = -1;
int lenght = -1;
position = totalString.indexOf(foo) + foo.length();
String processedString =
totalString.substring(position);
Thanks for the post,
Did the job perfectly!
cheers again

How to use text-by-speech for N80?

I have been reading some posts here and there, but I havent seen anywhere where it states that text by speech works or does not work for N80? I was hoping somebody coud tell me, if it does work how do you install it?
Thank you so much

text to speech is a feature on a certainphone eg E90.the phone has to support text to speech.And the software that u download is only the langague for text to speech.
At last a nseries phone im truely happy with THE N82

How can I make rectangular speech bubbles that adapt to the text inside them without the "arrow" that points towards where the bubble is coming from getting changed?

I have to make lots of speech bubbles (150+) that all have texts inside them which differ in length. I want the speech bubbles to look the same in terms of style, but I need different sizes of course for each text. This means that the rectangular part of the speech bubble should adapt in length and width to the text inside it, while the "arrow" pointing towards where the bubble is coming from (e.g. the person who speaks) should stay the same on every bubble. So is there a way or a workaround to make such "adapting" speech bubbles?
I appreciate any kinds of help
Thanks in advance!

Here's another way I found:
1. Draw a speech bubble. Mine is a rectangle with rounded corners and a triangular pointer added with Pathfinder > Add
2. Drag out a frame the same size as the speech bubble. Select the speech bubble and Copy; then select the empty frame and choose Edit > Paste Into...
3. Alt-Drag the frame with the pasted speech bubble to make a copy, then crop one copy to leave only the top of the bubble showing, and crop the other copy to leave only the bottom.
4. Drag out a text frame and insert a table consisting of 1 column, 3 rows. Set the text frame to Autosize > Height Only.
5. Set the stroke/fill of the top and bottom rows to none, and style the middle row to match the speech bubble, (in my case a white fill and 2pt stroke; left and right).
6. Anchor (paste) a copy of the speech bubble top in the top table row, and a copy of the speech bubble bottom in the bottom row.
Getting the 3 parts to match up with is where you just have to work on it until you get it right. Use the positioning tools in Anchored Object options and the column width setting in Cell options to line everything up.
Enter your text in the middle row. (Hey, look at that...a valid application of Comic Sans!) With the Cell Height set to an "At Least" setting, the cell will expand to fit whatever text you enter, pushing the the bottom row down, with the text frame auto-sizing to keep everything in play...

How to remove a software update file that hasn't been installed?

how do I remove a software update application downloaded from the software updates but not installed yet?
thanks

Hi masagaadaygbisa ..
Go to the folder [your HD]/library/reciepts and remove the update .. That should help ..

How to remove from iPad music files that do not appear in iTunes?

A 'phantom' music Album files appears on my iPad, in the Albums view of the Music menu. The album cannot be played and the three tracks on it appear greyed out when it is selected. It is not present in my iTunes library on my PC. Is there anyway that this file can be deleted or at least removed from the Music/Albums view?
Similarly, I downloaded a free track from iTunes directly to my iPad. This now shows on both my iPad and iTunes on my PC. However, I do not wish to keep the track on my iPad. Removing it from the playlist that sync's to the iPad does not remove it from the iPad. Is there a way to resolve this additional issue?
iPad is an iPad 2 with iOS 5.0.1. iTunes is version 10.5.2.11 on a Windows 7 laptop PC.
Thanks, any suggestions welcome.

If you try syncing with iTunes again, perhaps the phantom album will be erased since it does not exist on the computer.
Have you tried restarting or maybe resetting the iPad to see if the album will disappear?
Restart the iPad by holding down on the sleep button until the red slider appears and then slide to shut off. To power up hold the sleep button until the Apple logo appears and let go of the button.
Reset the iPad by holding down on the sleep and home buttons at the same time for about 10-15 seconds until the Apple Logo appears - ignore the red slider - let go of the buttons.

How to remove the the red dot that is stuck on the voice mail icone ?

I'm trying to remove the alert red dot that is stuck on the voice mail icone . Iturned phone off and reopened it, I went into settings and removed the alert from "Messages" icone from Notification Center. help please ...

Try a reset: hold down the home button along with the sleep/wake button until the screen goes black and you see the Apple, then let go. (No data loss)

E5: how to remove text to speech.......so that my ...

Similar Messages

Maybe you are looking for