How to remove text from JTable ...........

AOA
How to remove the text from cells of JPanel. Just to refresh the GUI.
regards

How to provide meaningful subject?
The subject of this thread does not match what you are asking in the body.
To set the value of a cell in a JTable, you can simply call setValueAt().
Read the API to find the method parameters.

Similar Messages

How to remove text from .swf animation?

how to remove text from .swf animation? Can no find this text
in fla file. Flash 8.

exactly what 'text' are you referring to? text that you typed
on the Stage using the 'textTool'? simply select the text with the
'arrowTool' and hit delete.
If you are referring to a textField that you want to
eliminate after a certain amount of time, within your animation
sequence. first copy the text, create a new layer, paste the text
in place, then where you want to have the text 'disappear' insert a
'blank keyframe' at that point in the text layer.
OR place the textfield within a MC and remove it with code.
OR if the text is dynamic and you wish to use the position at a
later time, pass a value of null or and empty string to the field
at the point you wish. And there are other ways still. :) hope one
of these works for you.

How to remove text from photo only one layer?

How do I remove text from this photo? plz & ty
o I remove text from a photo?

Contact the person who took the photo and ask for a clean copy.
If you don't know the photographer, chances are good that your use of the photo would be a violation of copyright.

How to Remove Text From Strings ?

Hi,
The question I have is, in the String that I have Pasted below, how can I remove the first line (>gi|23821530|dbj||SEG_D10989S Bos taurus gene for endothelin receptor) and then use the remainder of the text to Post to a web server?
I have tried doing this with a Regex (Pattern P = Pattern.compile("(^>.*)");), I'm able to capture the first line of text, but am not sure how to remove it and then use the rest of the text to Post to the web server.
Any Help with this would be much appreciated
gi|23821530|dbj||SEG_D10989S Bos taurus gene for endothelin receptorGGGATCCCGAGCAAACTGCGGAGGCCACACTGTCAGGCATTCCCTCGGCGTTTCGTCAGAGCCAGACCCT
CCCGCTGCTGAAGGGAGGCGCGCTCTGCTCCCGGGCTGCCGGGAACCCAGCCGCGCGCCGGGGAAGGAGG
TCCCTGCCTGGTGCGTCCGGACCAAGAGGTAACCGTTCTGCTTGGTGTTTAATTCAAATCTGTGATTGAA
CCTTATCCTGGGGCTTCAGTTTGGATTACTTCTTAGGTTTGTTTTTGTTTGTTTGTTTGTTTTTTAACCT
GTAGCTACAGCAGATTAAAATGGGATTGGAGTGAAGGAGAGGGCTTGAGTGTCTGAAGTCACTCGAAGGG
GATAGAAACTTCCGAGTTAATCCAGATAGAGACTCTTCCAAATAGACCAAGTGGAGATGTCCGGGAGATT
TTCCGAGTCAGCCGGCTCAGTCCTGGGGTGTGTGTATGGGGGGTGGGGGCGGTGCCGAAGAGCGGAAGGA
AGGGGTCTGAAAGTCCAGACATGCGGCATCCGGGGTTGCTGTGGAGTCGAAAGCAGAGACTGGCGATGCC
CTTGATCTCTAACCTGCCTTGATTTGCCCCGTCCCCGCGCGCCCTTGGCCAGAACGAATACTGCTCCCTC
TGCGCACACCAGGAGCTCAAAGCTTTGCTTTGGACACCCGTCCTCTCCTCCCCGTCACACCCCTTCCAGG

String foo = "gi|23821530|dbj||SEG_D10989S Bos taurus
gene for endothelin receptor";
String totalString = "gi|23821530|dbj||SEG_D10989S Bos
taurus gene for endothelin receptor
GGGATCCCGAGCAAACTGCGGAGGCCACACTGTCAGGCATTCCCTCGGCGTTTCG
CAGAGCCAGACCCT
CCCGCTGCTGAAGGGAGGCGCGCTCTGCTCCCGGGCTGCCGGGAACCCAGCCGCG
GCCGGGGAAGGAGG
TCCCTGCCTGGTGCGTCCGGACCAAGAGGTAACCGTTCTGCTTGGTGTTTAATTC
AATCTGTGATTGAA
CCTTATCCTGGGGCTTCAGTTTGGATTACTTCTTAGGTTTGTTTTTGTTTGTTTG
TTGTTTTTTAACCT
GTAGCTACAGCAGATTAAAATGGGATTGGAGTGAAGGAGAGGGCTTGAGTGTCTG
AGTCACTCGAAGGG
GATAGAAACTTCCGAGTTAATCCAGATAGAGACTCTTCCAAATAGACCAAGTGGA
ATGTCCGGGAGATT
TTCCGAGTCAGCCGGCTCAGTCCTGGGGTGTGTGTATGGGGGGTGGGGGCGGTGC
GAAGAGCGGAAGGA
AGGGGTCTGAAAGTCCAGACATGCGGCATCCGGGGTTGCTGTGGAGTCGAAAGCA
AGACTGGCGATGCC
CTTGATCTCTAACCTGCCTTGATTTGCCCCGTCCCCGCGCGCCCTTGGCCAGAAC
AATACTGCTCCCTC
TGCGCACACCAGGAGCTCAAAGCTTTGCTTTGGACACCCGTCCTCTCCTCCCCGT
ACACCCCTTCCAGG";
int position = -1;
int lenght = -1;
position = totalString.indexOf(foo) + foo.length();
String processedString =
totalString.substring(position);
Thanks for the post,
Did the job perfectly!
cheers again

How to remove text from mp4 video

hi all,
i have a mp4 video of 30 seconds.
the video has a text appearing on left side and bottom of the video.
i want to remove that text using premiere but im very new to video editing.
any steps of "how to do" or guidance will be great help.
thanks

Sharma,
While not easy in the best of circumstances, depending on what you have, and what you need to do, there are some possibilities, and one might help.
First, I would attach a screen-cap of the that Video. You might need to post a couple, if things change dramatically in the Frame. No promises, but there might be some options.
However, if you can take Jim's suggestion, and get the footage without the Text, things will be so much easier.
Also, do you have access to Adobe After Effects?
How about Photoshohop Extended, CS 6, or CC?
If it cannot be done in PrPro (fewer Tools to employ), it might be possible in AE, or Ps (through Rotoscoping).
Let us see what you have, and someone will try to help, though remember that the answer might be just as CC_Merchant says, "No."
Good luck,
Hunt

Help with removing text from background

Hi,
I'm pretty new to this, but I'm trying to figure out how to remove text from a background. My problem is that when I use tools to grab the text, it only selects part of it because the pixels of the text are actually different colors as it blends in with the backgorund. Does anyone have a quick idea how to do this?
Thanks
<link removed>

Don't you like to see people's websites/projects/works in forums? Seems to me that you get to know people and what they are into when they post their work. Anyways in the spirit of you helping me, here is the picture.
I'm trying to remove the letters from the background. Everything about the letters including the shadows.
Thanks

Help! Trying to remove text from an already saved image

I accidently saved an image with my watermark & now the image is locked & also saved as a jpeg image. I can't remove the text without stamping it out or just starting over. Does anyone know how to remove text from an image that has already been saved?

You could have saved it before closing the image. As long as the image is open in Editor, we can always go back to the original position and get back the original file.
In case you have closed, check if you have saved it as a version set. If your file name contains "edited-1" something, you have the file preserved.
Otherwise, if you have replaced the file without having any copy of it anywhere else, you cannot revert the changes.

Add and remove columns from JTable

Help me please!
A try to remove column from JTable. It's removed, but when I try to add column in table, then I get all old (removed early) columns + new column....
I completely confused with it.....
Here is my code for remove column:
class DelC implements ActionListener
          public void actionPerformed (ActionEvent e )
               int [] HowManyColDelete = table.getSelectedColumns();
               if (HowManyColDelete.length !=0)
                    TableColumnModel tableCModel = table.getColumnModel();
                    for (int i = HowManyColDelete.length-1; i>-1; i--)
                         table.getColumnModel().removeColumn (tableCModel.getColumn (HowManyColDelete [ i ]));
               else
                      JOptionPane.showMessageDialog(JOptionPane.getRootFrame(), "Column is not selected!");
     }

It's little ex for me, I just try understand clearly how it's work (table models i mean). Here is code. All action with tables take place through menu items.
My brain is boiled, I've try a lot of variants of code, but did't get right result :((
It's code represent problem, which I've describe above. If you'll try remove column and then add it again, it will be ma-a-a-any colunms...
I understand, that my code just hide columns, not delete from table model....
But now I have not any decision of my problem...
Thanks a lot for any help. :)
import javax.swing.*;
import java.awt.*;
import javax.swing.table.*;
import java.awt.event.*;
import javax.swing.table.DefaultTableModel;
class JTableF extends JFrame
     Object [] [] data = new Object [0] [2];
     JTable table;
     DefaultTableModel model;
     String [] columnNames = {"1", "2"};
     TableColumnModel cm;
     JTableF()
          super("Table features");
          setDefaultLookAndFeelDecorated( true );
          setDefaultCloseOperation (JFrame.EXIT_ON_CLOSE);
          JMenuBar MBar = new JMenuBar();
          JMenu [] menus = {new JMenu("A"), new JMenu("B")};
          JMenuItem [] menu1 = {new JMenuItem("Add row"), new JMenuItem("Delete row", 'D'), new JMenuItem("Add column"), new JMenuItem("Delete column")};
          menu1 [ 0 ].addActionListener(new AddL());
          menu1 [ 1 ].addActionListener(new DelL());
          menu1 [ 2 ].addActionListener(new AddC());
          menu1 [ 3 ].addActionListener(new DelC());
          for (int i=0; i<menu1.length; i++)
               menus [ 0 ].add( menu1 [ i ]);
          for (int i=0; i<menus.length; i++)
               MBar.add(menus );
          JPanel panel = new JPanel ();
          model = new DefaultTableModel( data, columnNames );
          table = new JTable (model);
          cm = table.getColumnModel();
          panel.add (new JScrollPane(table));
          JButton b = new JButton ("Add row button");
          b.addActionListener(new AddL());
          panel.add (b);
          setJMenuBar (MBar);
          getContentPane().add(panel);
          pack();
          setLocationRelativeTo (null);
          setVisible (true);
     class DelC implements ActionListener
          public void actionPerformed (ActionEvent e )
               int [] HowManyColDelete = table.getSelectedColumns();
               if (HowManyColDelete.length !=0)
                    TableColumnModel tableCModel = table.getColumnModel();
                    for (int i = HowManyColDelete.length-1; i>-1; i--)
                         int vizibleCol = table.convertColumnIndexToView(HowManyColDelete [ i ]);
                         tableCModel.removeColumn (tableCModel.getColumn (vizibleCol));
                    //cm = tableCModel;
               else
                    JOptionPane.showMessageDialog(JOptionPane.getRootFrame(), "Column is not selected!");
     class AddC implements ActionListener
          public void actionPerformed (ActionEvent e)
               //table.setColumnModel(cm);
               Object NewColumnName = new String();
               NewColumnName = JOptionPane.showInputDialog ("Input new column name", "Here");
               int i = model.getRowCount();
               int j = model.getColumnCount();
               Object [] newData = new Object [ i ];
               model.addColumn ( NewColumnName, newData);
     class AddL implements ActionListener
          public void actionPerformed (ActionEvent e)
               int i = model.getColumnCount();
               Object [] Row = new Object [ i ];
               model.addRow ( Row );
     class DelL implements ActionListener
          public void actionPerformed (ActionEvent e)
               int [] HowManyRowsDelete = table.getSelectedRows();
               if (HowManyRowsDelete.length !=0)
                    for (int k = HowManyRowsDelete.length-1; k>-1; k--)
                         model.removeRow (HowManyRowsDelete[k]);
               else
                    JOptionPane.showMessageDialog(JOptionPane.getRootFrame(), "Row is not selected!");
     public static void main (String [] args)
          javax.swing.SwingUtilities.invokeLater(new Runnable()
               public void run()
                    JTableF inst = new JTableF();

How to print texts from iphone 4

how to print text from iphone 4 without having to screenshot?

An iOS cannot be downgraded or uninstalled...Apple has never supported doing this and removes the older iOS version files when a new iOS is released.

How to extract text from a PDF file?

Hello Suners,
i need to know how to extract text from a pdf file?
does anyone know what is the character encoding in pdf file, when i use an input stream to read the file it gives encrypted characters not the original text in the file.
is there any procedures i should do while reading a pdf file,
File f=new File("D:/File.pdf");
               FileReader fr=new FileReader(f);
               BufferedReader br=new BufferedReader(fr);
               String s=br.readLine();any help will be deeply appreciated.

jverd wrote:
First, you set i once, and then loop without ever changing it. So your loop body will execute either 0 times or infinitely many times, writing the same byte every time. Actually, maybe it'll execute once and then throw an ArrayIndexOutOfBoundsException. That's basic java looping, and you're going to need a firm grip on that before you try to do anything as advanced as PDF reading. the case.oops you are absolutely right that was a silly mistake to forget that,
Second, what do the docs for getPageContent say? Do they say that it simply gives you the text on the page as if the thing were a simple text doc? I'd be surprised if that's the case.getPageContent return array of bytes so the question will be:
how to get text from this array? i was thinking of :
    private void jButton1_actionPerformed(ActionEvent e) {
        PdfReader read;
        StringBuffer buff=new StringBuffer();
        try {
            read = new PdfReader("d:/getjobid2727.pdf");
            read.getMetaData();
            byte[] data=read.getPageContent(1);
            int i=0;
            while(i>-1){
                buff.append(data);
i++;
String str=buff.toString();
FileOutputStream fos = new FileOutputStream("D:/test.txt");
Writer out = new OutputStreamWriter(fos, "UTF8");
out.write(str);
out.close();
read.close();
} catch (Exception f) {
f.printStackTrace();
"D:/test.txt" hasn't been created!! when i ran the program,
is my steps right?

How to extract text from a PDF file using php?

How to extract text from a PDF file using php?
thanks
fabio

> Do you know of any other way this can be done?
There are many ways. But this out of scope of this forum. You can try this forum: http://forum.planetpdf.com/

How to email text from a text component in my applet on a the host server ?

How to email text from a text component in my applet on a the host server, back to my email address ?
Assuming I have Email Form on the host server.
Help will be appreciated.

You can do like below
=REPLACE(Fields!Column.Value," " & Parameters!ParameterName.value & " ","<b>" & Parameters!ParameterName.value & "</b>")
The select the expression and right click and choose placeholder properties
Inside that set Markup type as HTML
then it will highlight the passed parameter value in bold within the full xml string
Please Mark This As Answer if it helps to solve the issue Visakh ---------------------------- http://visakhm.blogspot.com/ https://www.facebook.com/VmBlogs

HT1386 The first time I synced my iphone with my mac, I didn't realize that all of my photos from iphoto would transfer over to the phone. Now, I need to remove some, as they are taking up too much space. I cannot figure out how to remove them from the

The first time I synced my iphone 4 with my mac, I didn't realize that all of my photos from the iphoto library would transfer over to the phone (more than 3,000). Now, I need to remove some, as they are taking up too much space. I cannot figure out how to remove them from the phone. I tried to uncheck boxes and sync again, but I get a message that there is no room on the iphone. I've read as many articles as I can find, but still cannot manage this. Thanks for any help.

Open itunes, connect iphone, select what you want, sync

How to remove pics from my 3GS...???

How to remove pics from my 3GS..???

Photos taken with the phone can be deleted by selecting them and hitting the little wastebasket icon in the right bottom corner.
Photos you did sync to your phone, can only be removed by deselecting them in the photo pane in iTunes, the following sync will remove them from the phone.

Does anyone know how to remove images from google

i had instagram and i didnt upload images of myself but i only used my own image in the display picture and some how it has gone on to the google image search yesterday i deleted my account but when i checked to see if my images do appear in the google images i had some really bad regrets !! i reallywant to know how i can remove pictures off the google image search even doe this does not kind of relate thank you .

Does anyone know how to remove vocals from an import from I tunes...a polyphonic stereo mix ?
If you are talking about some "Karaoke" method using Logic I'll try to offer one. Before that I must say that most of the Karaoke methods are based on reversing the Phase of one of the stereo channel and bussing or merging the stereo into Mono. The result is: killing all Pan Centered in the mix - like Main Vocal, Bass, Kick, SN ect.
The artifacts of the Stereo FX of the main vocal will stay in the Karaoke, cause the FX is stereo etc.
Here is the Logic Setup I can offer to try some Karaoke trick using Logic.
1. Import a Stereo mix into a Logic Stereo track.
2. Create another stereo track and duplicate (copy) the Original Mix region to the duplicated track.
3. Hard Pan L/R both stereo tracks.
4. Insert an EQ and Gainer plugins into the duplicated track (R).
5. Set the Output select of the both tracks to a Bus and assign the new Aux Track Switch mode to "Mono".
6. Open the Gainer plugin and thick the "Phase Invert" Right button.
7. To keep the "lowend" instruments like the bass and kick, open the EQ plugin and enable the Low Cut filter and try some Hz settings 80-115, or different Q which will sounds better for your Karaoke.
P.S Click the image below to show its real resolution!
Regards,
A.G
======================================
www.audiogrocery.com
Author of: Logic GUI Deluxe(Free), Vox De Bulgaria s.a.g.e vocal pack for RMX, Logic Snapshot Console, RMX Power CTRL - Logic Environment Midi editor for Stylus etc.
======================================

How to remove text from JTable ...........

Similar Messages

Maybe you are looking for