How to remove text from mp4 video
hi all,
i have a mp4 video of 30 seconds.
the video has a text appearing on left side and bottom of the video.
i want to remove that text using premiere but im very new to video editing.
any steps of "how to do" or guidance will be great help.
thanks
Sharma,
While not easy in the best of circumstances, depending on what you have, and what you need to do, there are some possibilities, and one might help.
First, I would attach a screen-cap of the that Video. You might need to post a couple, if things change dramatically in the Frame. No promises, but there might be some options.
However, if you can take Jim's suggestion, and get the footage without the Text, things will be so much easier.
Also, do you have access to Adobe After Effects?
How about Photoshohop Extended, CS 6, or CC?
If it cannot be done in PrPro (fewer Tools to employ), it might be possible in AE, or Ps (through Rotoscoping).
Let us see what you have, and someone will try to help, though remember that the answer might be just as CC_Merchant says, "No."
Good luck,
Hunt
Similar Messages
-
How to remove text from .swf animation?
how to remove text from .swf animation? Can no find this text
in fla file. Flash 8.exactly what 'text' are you referring to? text that you typed
on the Stage using the 'textTool'? simply select the text with the
'arrowTool' and hit delete.
If you are referring to a textField that you want to
eliminate after a certain amount of time, within your animation
sequence. first copy the text, create a new layer, paste the text
in place, then where you want to have the text 'disappear' insert a
'blank keyframe' at that point in the text layer.
OR place the textfield within a MC and remove it with code.
OR if the text is dynamic and you wish to use the position at a
later time, pass a value of null or and empty string to the field
at the point you wish. And there are other ways still. :) hope one
of these works for you. -
How to remove text from photo only one layer?
How do I remove text from this photo? plz & ty
o I remove text from a photo?Contact the person who took the photo and ask for a clean copy.
If you don't know the photographer, chances are good that your use of the photo would be a violation of copyright. -
AOA
How to remove the text from cells of JPanel. Just to refresh the GUI.
regardsHow to provide meaningful subject?
The subject of this thread does not match what you are asking in the body.
To set the value of a cell in a JTable, you can simply call setValueAt().
Read the API to find the method parameters. -
How to Remove Text From Strings ?
Hi,
The question I have is, in the String that I have Pasted below, how can I remove the first line (>gi|23821530|dbj||SEG_D10989S Bos taurus gene for endothelin receptor) and then use the remainder of the text to Post to a web server?
I have tried doing this with a Regex (Pattern P = Pattern.compile("(^>.*)");), I'm able to capture the first line of text, but am not sure how to remove it and then use the rest of the text to Post to the web server.
Any Help with this would be much appreciated
gi|23821530|dbj||SEG_D10989S Bos taurus gene for endothelin receptorGGGATCCCGAGCAAACTGCGGAGGCCACACTGTCAGGCATTCCCTCGGCGTTTCGTCAGAGCCAGACCCT
CCCGCTGCTGAAGGGAGGCGCGCTCTGCTCCCGGGCTGCCGGGAACCCAGCCGCGCGCCGGGGAAGGAGG
TCCCTGCCTGGTGCGTCCGGACCAAGAGGTAACCGTTCTGCTTGGTGTTTAATTCAAATCTGTGATTGAA
CCTTATCCTGGGGCTTCAGTTTGGATTACTTCTTAGGTTTGTTTTTGTTTGTTTGTTTGTTTTTTAACCT
GTAGCTACAGCAGATTAAAATGGGATTGGAGTGAAGGAGAGGGCTTGAGTGTCTGAAGTCACTCGAAGGG
GATAGAAACTTCCGAGTTAATCCAGATAGAGACTCTTCCAAATAGACCAAGTGGAGATGTCCGGGAGATT
TTCCGAGTCAGCCGGCTCAGTCCTGGGGTGTGTGTATGGGGGGTGGGGGCGGTGCCGAAGAGCGGAAGGA
AGGGGTCTGAAAGTCCAGACATGCGGCATCCGGGGTTGCTGTGGAGTCGAAAGCAGAGACTGGCGATGCC
CTTGATCTCTAACCTGCCTTGATTTGCCCCGTCCCCGCGCGCCCTTGGCCAGAACGAATACTGCTCCCTC
TGCGCACACCAGGAGCTCAAAGCTTTGCTTTGGACACCCGTCCTCTCCTCCCCGTCACACCCCTTCCAGGString foo = "gi|23821530|dbj||SEG_D10989S Bos taurus
gene for endothelin receptor";
String totalString = "gi|23821530|dbj||SEG_D10989S Bos
taurus gene for endothelin receptor
GGGATCCCGAGCAAACTGCGGAGGCCACACTGTCAGGCATTCCCTCGGCGTTTCG
CAGAGCCAGACCCT
CCCGCTGCTGAAGGGAGGCGCGCTCTGCTCCCGGGCTGCCGGGAACCCAGCCGCG
GCCGGGGAAGGAGG
TCCCTGCCTGGTGCGTCCGGACCAAGAGGTAACCGTTCTGCTTGGTGTTTAATTC
AATCTGTGATTGAA
CCTTATCCTGGGGCTTCAGTTTGGATTACTTCTTAGGTTTGTTTTTGTTTGTTTG
TTGTTTTTTAACCT
GTAGCTACAGCAGATTAAAATGGGATTGGAGTGAAGGAGAGGGCTTGAGTGTCTG
AGTCACTCGAAGGG
GATAGAAACTTCCGAGTTAATCCAGATAGAGACTCTTCCAAATAGACCAAGTGGA
ATGTCCGGGAGATT
TTCCGAGTCAGCCGGCTCAGTCCTGGGGTGTGTGTATGGGGGGTGGGGGCGGTGC
GAAGAGCGGAAGGA
AGGGGTCTGAAAGTCCAGACATGCGGCATCCGGGGTTGCTGTGGAGTCGAAAGCA
AGACTGGCGATGCC
CTTGATCTCTAACCTGCCTTGATTTGCCCCGTCCCCGCGCGCCCTTGGCCAGAAC
AATACTGCTCCCTC
TGCGCACACCAGGAGCTCAAAGCTTTGCTTTGGACACCCGTCCTCTCCTCCCCGT
ACACCCCTTCCAGG";
int position = -1;
int lenght = -1;
position = totalString.indexOf(foo) + foo.length();
String processedString =
totalString.substring(position);
Thanks for the post,
Did the job perfectly!
cheers again -
NightShot Effect...how to remove it from original video
Hello, I recorded about an hour worth of video with my camcorder and the NightShot effect was on... so now I want to put this video on dvd....I was wondering if theres a plugin effect for imovie 5 to remove that nightshot effect and get the colors back again, that green effect looks awful...thank you
... Greg, + for that, my first idea too, ok, in case the camcorder has some additional IR-light, the eyes look a little... spookey, but anyhow.
besides, making videos b/w, plus adding some black borders top/buttom (cinema effect), and if possible add a little slow-mo can make them looking very "stylish"... -
Help with removing text from background
Hi,
I'm pretty new to this, but I'm trying to figure out how to remove text from a background. My problem is that when I use tools to grab the text, it only selects part of it because the pixels of the text are actually different colors as it blends in with the backgorund. Does anyone have a quick idea how to do this?
Thanks
<link removed>Don't you like to see people's websites/projects/works in forums? Seems to me that you get to know people and what they are into when they post their work. Anyways in the spirit of you helping me, here is the picture.
I'm trying to remove the letters from the background. Everything about the letters including the shadows.
Thanks -
Help! Trying to remove text from an already saved image
I accidently saved an image with my watermark & now the image is locked & also saved as a jpeg image. I can't remove the text without stamping it out or just starting over. Does anyone know how to remove text from an image that has already been saved?
You could have saved it before closing the image. As long as the image is open in Editor, we can always go back to the original position and get back the original file.
In case you have closed, check if you have saved it as a version set. If your file name contains "edited-1" something, you have the file preserved.
Otherwise, if you have replaced the file without having any copy of it anywhere else, you cannot revert the changes. -
How to print texts from iphone 4
how to print text from iphone 4 without having to screenshot?
An iOS cannot be downgraded or uninstalled...Apple has never supported doing this and removes the older iOS version files when a new iOS is released.
-
How to extract text from a PDF file?
Hello Suners,
i need to know how to extract text from a pdf file?
does anyone know what is the character encoding in pdf file, when i use an input stream to read the file it gives encrypted characters not the original text in the file.
is there any procedures i should do while reading a pdf file,
File f=new File("D:/File.pdf");
FileReader fr=new FileReader(f);
BufferedReader br=new BufferedReader(fr);
String s=br.readLine();any help will be deeply appreciated.jverd wrote:
First, you set i once, and then loop without ever changing it. So your loop body will execute either 0 times or infinitely many times, writing the same byte every time. Actually, maybe it'll execute once and then throw an ArrayIndexOutOfBoundsException. That's basic java looping, and you're going to need a firm grip on that before you try to do anything as advanced as PDF reading. the case.oops you are absolutely right that was a silly mistake to forget that,
Second, what do the docs for getPageContent say? Do they say that it simply gives you the text on the page as if the thing were a simple text doc? I'd be surprised if that's the case.getPageContent return array of bytes so the question will be:
how to get text from this array? i was thinking of :
private void jButton1_actionPerformed(ActionEvent e) {
PdfReader read;
StringBuffer buff=new StringBuffer();
try {
read = new PdfReader("d:/getjobid2727.pdf");
read.getMetaData();
byte[] data=read.getPageContent(1);
int i=0;
while(i>-1){
buff.append(data);
i++;
String str=buff.toString();
FileOutputStream fos = new FileOutputStream("D:/test.txt");
Writer out = new OutputStreamWriter(fos, "UTF8");
out.write(str);
out.close();
read.close();
} catch (Exception f) {
f.printStackTrace();
"D:/test.txt" hasn't been created!! when i ran the program,
is my steps right? -
How to extract text from a PDF file using php?
How to extract text from a PDF file using php?
thanks
fabio> Do you know of any other way this can be done?
There are many ways. But this out of scope of this forum. You can try this forum: http://forum.planetpdf.com/ -
How to email text from a text component in my applet on a the host server ?
How to email text from a text component in my applet on a the host server, back to my email address ?
Assuming I have Email Form on the host server.
Help will be appreciated.You can do like below
=REPLACE(Fields!Column.Value," " & Parameters!ParameterName.value & " ","<b>" & Parameters!ParameterName.value & "</b>")
The select the expression and right click and choose placeholder properties
Inside that set Markup type as HTML
then it will highlight the passed parameter value in bold within the full xml string
Please Mark This As Answer if it helps to solve the issue Visakh ---------------------------- http://visakhm.blogspot.com/ https://www.facebook.com/VmBlogs -
How can I get an mp4 video running on iPad Mini?
How can I get an mp4 video running on iPad Mini, which is already in the iTunes File?
Pad2, the new iPad Supported Video Formats & Movie Formats
H.264 video up to 1080p, 30 frames per second, High Profile level 4.1 with AAC-LC audio up to 160 Kbps, 48kHz, stereo audio in .m4v, .mp4, and .mov file formats;
MPEG-4 video up to 2.5 Mbps, 640 by 480 pixels, 30 frames per second, Simple Profile with AAC-LC audio up to 160 Kbps per channel, 48kHz, stereo audio in .m4v, .mp4, and .mov file formats;
Motion JPEG (M-JPEG) up to 35 Mbps, 1280 by 720 pixels, 30 frames per second, audio in ulaw, PCM stereo audio in .avi file format
You can use a USB flash drive & the camera connection kit.
Plug the USB flash drive into your computer & create a new folder titled DCIM. Then put your movie/photo files into the folder. The files must have a filename with exactly 8 characters long (no spaces) plus the file extension (i.e., my-movie.mov; DSCN0164.jpg).
Now plug the flash drive into the iPad using the camera connection kit. Open the Photos app, the movie/photo files should appear & you can import. (You can not export using the camera connection kit.)
Cheers, Tom -
The first time I synced my iphone 4 with my mac, I didn't realize that all of my photos from the iphoto library would transfer over to the phone (more than 3,000). Now, I need to remove some, as they are taking up too much space. I cannot figure out how to remove them from the phone. I tried to uncheck boxes and sync again, but I get a message that there is no room on the iphone. I've read as many articles as I can find, but still cannot manage this. Thanks for any help.
Open itunes, connect iphone, select what you want, sync
-
How to remove pics from my 3GS...???
How to remove pics from my 3GS..???
Photos taken with the phone can be deleted by selecting them and hitting the little wastebasket icon in the right bottom corner.
Photos you did sync to your phone, can only be removed by deselecting them in the photo pane in iTunes, the following sync will remove them from the phone.
Maybe you are looking for
-
How to print special characters in sqpllus gui, for example "double dagger"
Hello, I have a SOAP call procedure which retrieves data which is delimited by " double dagger", on screen I get a filled block instead of ‡. If I do a copy/paste in here, the double dagger shows up, but not in sqlplus. how can I resolve this? Thanks
-
Sign in to Icloud keeps popping up
The email address I have registered for Icloud is no longer in use and therefore I cannot remember / retrieve the password. Recently a message 'Sign into Icloud is popping up every 30 secs to 2 minutes? I cannot seem to be able to use FaceTime either
-
My dial up connection keeps disconnecting!!!
hi... my dial up spends a while to even connect!!! most of the time it will just say that it does not detect a dial tone... but ive checked with other computers on the same line and its no problem... i even checked with the internet provider... pleas
-
FB 4.5 Premium installer gives error 1603
Downloaded Flash Builder 4.5 premium from the Adobe site, used Application Manager to create a deployable package. It bombs out with a 1603, no hints at all in the 237 kb log file as to why. Google isn't helping.
-
Hi i need to create an Alarm UI in JSP page. Like what Time CPU,Memory ,concurrent value goes above the marked value(90% usage) should be highlight in different colour like Red. All this data are stored on Oracle database. need to show in an JSP Can