How to remove text from photo only one layer?
How do I remove text from this photo? plz & ty
o I remove text from a photo?
Contact the person who took the photo and ask for a clean copy.
If you don't know the photographer, chances are good that your use of the photo would be a violation of copyright.
Similar Messages
-
How to remove text from .swf animation?
how to remove text from .swf animation? Can no find this text
in fla file. Flash 8.exactly what 'text' are you referring to? text that you typed
on the Stage using the 'textTool'? simply select the text with the
'arrowTool' and hit delete.
If you are referring to a textField that you want to
eliminate after a certain amount of time, within your animation
sequence. first copy the text, create a new layer, paste the text
in place, then where you want to have the text 'disappear' insert a
'blank keyframe' at that point in the text layer.
OR place the textfield within a MC and remove it with code.
OR if the text is dynamic and you wish to use the position at a
later time, pass a value of null or and empty string to the field
at the point you wish. And there are other ways still. :) hope one
of these works for you. -
AOA
How to remove the text from cells of JPanel. Just to refresh the GUI.
regardsHow to provide meaningful subject?
The subject of this thread does not match what you are asking in the body.
To set the value of a cell in a JTable, you can simply call setValueAt().
Read the API to find the method parameters. -
How to Remove Text From Strings ?
Hi,
The question I have is, in the String that I have Pasted below, how can I remove the first line (>gi|23821530|dbj||SEG_D10989S Bos taurus gene for endothelin receptor) and then use the remainder of the text to Post to a web server?
I have tried doing this with a Regex (Pattern P = Pattern.compile("(^>.*)");), I'm able to capture the first line of text, but am not sure how to remove it and then use the rest of the text to Post to the web server.
Any Help with this would be much appreciated
gi|23821530|dbj||SEG_D10989S Bos taurus gene for endothelin receptorGGGATCCCGAGCAAACTGCGGAGGCCACACTGTCAGGCATTCCCTCGGCGTTTCGTCAGAGCCAGACCCT
CCCGCTGCTGAAGGGAGGCGCGCTCTGCTCCCGGGCTGCCGGGAACCCAGCCGCGCGCCGGGGAAGGAGG
TCCCTGCCTGGTGCGTCCGGACCAAGAGGTAACCGTTCTGCTTGGTGTTTAATTCAAATCTGTGATTGAA
CCTTATCCTGGGGCTTCAGTTTGGATTACTTCTTAGGTTTGTTTTTGTTTGTTTGTTTGTTTTTTAACCT
GTAGCTACAGCAGATTAAAATGGGATTGGAGTGAAGGAGAGGGCTTGAGTGTCTGAAGTCACTCGAAGGG
GATAGAAACTTCCGAGTTAATCCAGATAGAGACTCTTCCAAATAGACCAAGTGGAGATGTCCGGGAGATT
TTCCGAGTCAGCCGGCTCAGTCCTGGGGTGTGTGTATGGGGGGTGGGGGCGGTGCCGAAGAGCGGAAGGA
AGGGGTCTGAAAGTCCAGACATGCGGCATCCGGGGTTGCTGTGGAGTCGAAAGCAGAGACTGGCGATGCC
CTTGATCTCTAACCTGCCTTGATTTGCCCCGTCCCCGCGCGCCCTTGGCCAGAACGAATACTGCTCCCTC
TGCGCACACCAGGAGCTCAAAGCTTTGCTTTGGACACCCGTCCTCTCCTCCCCGTCACACCCCTTCCAGGString foo = "gi|23821530|dbj||SEG_D10989S Bos taurus
gene for endothelin receptor";
String totalString = "gi|23821530|dbj||SEG_D10989S Bos
taurus gene for endothelin receptor
GGGATCCCGAGCAAACTGCGGAGGCCACACTGTCAGGCATTCCCTCGGCGTTTCG
CAGAGCCAGACCCT
CCCGCTGCTGAAGGGAGGCGCGCTCTGCTCCCGGGCTGCCGGGAACCCAGCCGCG
GCCGGGGAAGGAGG
TCCCTGCCTGGTGCGTCCGGACCAAGAGGTAACCGTTCTGCTTGGTGTTTAATTC
AATCTGTGATTGAA
CCTTATCCTGGGGCTTCAGTTTGGATTACTTCTTAGGTTTGTTTTTGTTTGTTTG
TTGTTTTTTAACCT
GTAGCTACAGCAGATTAAAATGGGATTGGAGTGAAGGAGAGGGCTTGAGTGTCTG
AGTCACTCGAAGGG
GATAGAAACTTCCGAGTTAATCCAGATAGAGACTCTTCCAAATAGACCAAGTGGA
ATGTCCGGGAGATT
TTCCGAGTCAGCCGGCTCAGTCCTGGGGTGTGTGTATGGGGGGTGGGGGCGGTGC
GAAGAGCGGAAGGA
AGGGGTCTGAAAGTCCAGACATGCGGCATCCGGGGTTGCTGTGGAGTCGAAAGCA
AGACTGGCGATGCC
CTTGATCTCTAACCTGCCTTGATTTGCCCCGTCCCCGCGCGCCCTTGGCCAGAAC
AATACTGCTCCCTC
TGCGCACACCAGGAGCTCAAAGCTTTGCTTTGGACACCCGTCCTCTCCTCCCCGT
ACACCCCTTCCAGG";
int position = -1;
int lenght = -1;
position = totalString.indexOf(foo) + foo.length();
String processedString =
totalString.substring(position);
Thanks for the post,
Did the job perfectly!
cheers again -
How to remove text from mp4 video
hi all,
i have a mp4 video of 30 seconds.
the video has a text appearing on left side and bottom of the video.
i want to remove that text using premiere but im very new to video editing.
any steps of "how to do" or guidance will be great help.
thanksSharma,
While not easy in the best of circumstances, depending on what you have, and what you need to do, there are some possibilities, and one might help.
First, I would attach a screen-cap of the that Video. You might need to post a couple, if things change dramatically in the Frame. No promises, but there might be some options.
However, if you can take Jim's suggestion, and get the footage without the Text, things will be so much easier.
Also, do you have access to Adobe After Effects?
How about Photoshohop Extended, CS 6, or CC?
If it cannot be done in PrPro (fewer Tools to employ), it might be possible in AE, or Ps (through Rotoscoping).
Let us see what you have, and someone will try to help, though remember that the answer might be just as CC_Merchant says, "No."
Good luck,
Hunt -
How to remove tooltips from more than one field at a time?
I use the wizard and now there are more than 2000 fields with useless tooltips on each of them. How do I remove all the tooltips at once?
Run this code from the JS console:
for (var i=0; i<this.numFields; i++) {
var f = this.getField(this.getNthFieldName(i));
if (f==null) continue;
f.userName = ""; -
Help with removing text from background
Hi,
I'm pretty new to this, but I'm trying to figure out how to remove text from a background. My problem is that when I use tools to grab the text, it only selects part of it because the pixels of the text are actually different colors as it blends in with the backgorund. Does anyone have a quick idea how to do this?
Thanks
<link removed>Don't you like to see people's websites/projects/works in forums? Seems to me that you get to know people and what they are into when they post their work. Anyways in the spirit of you helping me, here is the picture.
I'm trying to remove the letters from the background. Everything about the letters including the shadows.
Thanks -
Help! Trying to remove text from an already saved image
I accidently saved an image with my watermark & now the image is locked & also saved as a jpeg image. I can't remove the text without stamping it out or just starting over. Does anyone know how to remove text from an image that has already been saved?
You could have saved it before closing the image. As long as the image is open in Editor, we can always go back to the original position and get back the original file.
In case you have closed, check if you have saved it as a version set. If your file name contains "edited-1" something, you have the file preserved.
Otherwise, if you have replaced the file without having any copy of it anywhere else, you cannot revert the changes. -
Applying feathering to only one layer
Hi,
I'm created a two-part ad. One of the two parts (on two different layers) has a background image that I would like only the center to show up and the rest I'd like to whiten (about 90% opacity, leaving 10% of the background image visible) using feathering, as described in Feather Selections In Photoshop With Quick Mask
So, does anyone know how to apply such feathering on only one layer?
Thanks!
-RonCreate a Layer Mask and apply Feather in the Properties Panel.
Could you please post a screenshot with the Layers Panel visible? -
How I forward text from one iphone 4 to other, only forward the calls
how I forward text from one iphone 4 to other, only forward the calls
you can't forward incoming texts to another phone automatically.
-
The first time I synced my iphone 4 with my mac, I didn't realize that all of my photos from the iphoto library would transfer over to the phone (more than 3,000). Now, I need to remove some, as they are taking up too much space. I cannot figure out how to remove them from the phone. I tried to uncheck boxes and sync again, but I get a message that there is no room on the iphone. I've read as many articles as I can find, but still cannot manage this. Thanks for any help.
Open itunes, connect iphone, select what you want, sync
-
On some pages the text from more than one paragraph stack up on top of each other, like writing something then writing something else over the top of it. Some pages will run text and pictures together, like a car rear-ending another or a train pile up. Other pages will cut an image or text short, i.e. it will display a portion of the top of the image or text but not the rest. This happens on Amazon for example, the section where it says "Customers who looked at this also looked at" will allow only a certain amount of the upper portion of the description immediately below the picture of the product but below that section everything is fine until I get to another section displaying more products and their descriptions and then it cuts the bottom portions off again. I've noticed this behavior mostly in the sections with product photos, the text sections seem okay. YouTube also displays this behavior. It's even doing it on this page right now. Below this box I can read "The more information you can provide the better chance your question will be answered " , but directly below that in the next sentence I can see the start of it with "Troublshootin" and the "Automatically Add" in a green field covering the "g". The next clear text is "A window will open in the top corner. Click Allow, and then click Install. If the automated way doesn't work, try these manual steps." I tried turning of pre-fetching, clearing history, cookies, and cache, scanning for malware with Avast and Windows Defender all to no avail. It began when I upgraded from dial up to DSL via AT&T Uverse. I have a Motorola NVG510 modem. The modem was replaced an hour ago along with new dedicated lines and DSL/Phone splitter from the box by an AT&T technician to make sure my incoming lines were up to par. He ran a connection test and verified everything is up to standards. IE does not display this behavior. I am running Firefox20.0.1 and all previous versions have acted the same way since I upgraded to DSL about 3 months ago.
If you have increased the minimum font size then try the default setting "none" in case the current setting is causing problems.
*Tools > Options > Content : Fonts & Colors > Advanced > Minimum Font Size (none)
Make sure that you allow websites to choose their fonts.
*Tools > Options > Content : Fonts & Colors > Advanced: [X] "Allow pages to choose their own fonts, instead of my selections above"
It is better not to increase the minimum font size, but use an extension to set the default page zoom to prevent issues with text not being displayed properly.
You can use an extension to set a default font size and page zoom on web pages.
*Default FullZoom Level: https://addons.mozilla.org/firefox/addon/default-fullzoom-level/
*NoSquint: https://addons.mozilla.org/firefox/addon/nosquint/ -
How to remove pics from my 3GS...???
How to remove pics from my 3GS..???
Photos taken with the phone can be deleted by selecting them and hitting the little wastebasket icon in the right bottom corner.
Photos you did sync to your phone, can only be removed by deselecting them in the photo pane in iTunes, the following sync will remove them from the phone. -
Does anyone know how to remove images from google
i had instagram and i didnt upload images of myself but i only used my own image in the display picture and some how it has gone on to the google image search yesterday i deleted my account but when i checked to see if my images do appear in the google images i had some really bad regrets !! i reallywant to know how i can remove pictures off the google image search even doe this does not kind of relate thank you .
Does anyone know how to remove vocals from an import from I tunes...a polyphonic stereo mix ?
If you are talking about some "Karaoke" method using Logic I'll try to offer one. Before that I must say that most of the Karaoke methods are based on reversing the Phase of one of the stereo channel and bussing or merging the stereo into Mono. The result is: killing all Pan Centered in the mix - like Main Vocal, Bass, Kick, SN ect.
The artifacts of the Stereo FX of the main vocal will stay in the Karaoke, cause the FX is stereo etc.
Here is the Logic Setup I can offer to try some Karaoke trick using Logic.
1. Import a Stereo mix into a Logic Stereo track.
2. Create another stereo track and duplicate (copy) the Original Mix region to the duplicated track.
3. Hard Pan L/R both stereo tracks.
4. Insert an EQ and Gainer plugins into the duplicated track (R).
5. Set the Output select of the both tracks to a Bus and assign the new Aux Track Switch mode to "Mono".
6. Open the Gainer plugin and thick the "Phase Invert" Right button.
7. To keep the "lowend" instruments like the bass and kick, open the EQ plugin and enable the Low Cut filter and try some Hz settings 80-115, or different Q which will sounds better for your Karaoke.
P.S Click the image below to show its real resolution!
Regards,
A.G
======================================
www.audiogrocery.com
Author of: Logic GUI Deluxe(Free), Vox De Bulgaria s.a.g.e vocal pack for RMX, Logic Snapshot Console, RMX Power CTRL - Logic Environment Midi editor for Stylus etc.
====================================== -
For me clicking outside of a TextInput should always remove focus from it, only only if you click on another TextInput or Button.
I don't see any simple event like MouseEvent.MOUSE_CLICK_OUTSIDE - which would definitely simplify things.. I wonder why there isn't such event. Well anyway I can't find any other similar event and I can't figure out an easy way to do this. I also wonder why I couldn't find a solution to this on the web easily... Well anyway...
Does someone know how to do that in a convenient way?
Thanks!ok I understand why is that. For example I have a TextInput now where the user enters number through buttons which have mouseFocusEnabled = false, so the TextInput doesn't lose focus. But on a TabBar I had to set mouseFocusEnabled = true or when I switched between tabs -> switches between states, I could still type in the TextInput in the previous tab cause it didn't lose focus. Maybe TabBar's default value of that property is wrongly set to false.
Anyway, not losing focus when clicking outside is still weird. Take for example this forum, if I click outside of the box I am currently writing this, I lose focus. It's how things usually work. And flex focus is designed to work backwards to what people are used to, no matter as I already pointed out I understand there are cases it comes in handly. I hope I don't sound bad but take it just as a suggestion please that maybe if it is redesigned like this: clicking on component gets focus, clicking outside loses focus. But if you click on a button for example and you want to keep the focus on a TextInput cause you add some text, you should be able to set a property on the Button like maintainCurrentFocus = true (false by default), which would make clicking on the Button not shift the focus to it or set it to null if the component is a group that has some rect background for example, but maintain the focus on the TextInput.
I could be missing something about the current design of how the focus works in flex, but from my point of view at the moment, the design I describe to use is just like how I am usually used to be working with focus as a user, not as developer.
Maybe you could agree or maybe you know some reason by which things are how they are at the moment that I don't see. But if you think I make sense please let me know, maybe I could fill a minor enhancement request for that ?
Maybe you are looking for
-
Error in Discussion Forum and Contacts iviews in SPS 20
Hi, We are facing a strange problem with the KM Discussion iview. Recently we upgraded from EP SP15 to SP20. After that, the KM Discussion iviews that we create are throwing errors when viewed. We tried transporting some iviews from a server running
-
Hi, i send via E-Mail Adapter an XML File. Is there a possibility to change the xml encoding. from: <?xml version="1.0" encoding="UTF-8" ?> to <?xml version="1.0" encoding="ISO-8859-1" ?> regards, robin
-
Program error sur photoshop cs4
could not complete your request because of a program error sur photoshop cs4 au moment de l'enregistrement
-
Moving iTunes music folder/library to external HD
Hi all, and happy new year: Yeah, I know I should know how to do this, but ... I want to move all my music to an external HD and delete it from my MBP HD. I would like someone to steer me to the best resource for a primer on how to do this. Thanks in
-
Google Chrome pop-up windows problems in Oracle BPM Workspace
Hi to everyone! I posted this thread in other location and nobody helps me. I think this location is the best. See the followin content please and help me! https://forums.oracle.com/thread/2529006?tstart=0 Regards.