How to remove text sent swoosh sound?

When I send a text I see/hear this annoying swoosh sound when it is sending the text.  My sound seeting are none and I do not want to have my iphone in silence or vibrate is it possible to remove that swoosh sound when text sent?

Tell Apple:
http://www.apple.com/feedback/iphone.html

Similar Messages

  • How to remove text from .swf animation?

    how to remove text from .swf animation? Can no find this text
    in fla file. Flash 8.

    exactly what 'text' are you referring to? text that you typed
    on the Stage using the 'textTool'? simply select the text with the
    'arrowTool' and hit delete.
    If you are referring to a textField that you want to
    eliminate after a certain amount of time, within your animation
    sequence. first copy the text, create a new layer, paste the text
    in place, then where you want to have the text 'disappear' insert a
    'blank keyframe' at that point in the text layer.
    OR place the textfield within a MC and remove it with code.
    OR if the text is dynamic and you wish to use the position at a
    later time, pass a value of null or and empty string to the field
    at the point you wish. And there are other ways still. :) hope one
    of these works for you.

  • How can I stop that swoosh sound when sending a text?

    If I text someone and hit send, I get that swoosh sound that it was sent. How can I disable it>

    clik "Settings" .... then clik "Sounds" , then swipe down to "Sent Mail" and turn it to "Off" .....

  • How do I get the swoosh sound back?

    I had to reinstall my operating system, and now don't have the swoosh sound when mail is sent. I thought I figured it out by going to System Preferences, Sound, and enabling Play user interface sound effects. But by doing that, I get all sorts of annoying sounds, particularly within iTunes. I know I did something before to get the mail swoosh, but not have sounds all the time from the user sound interface. Anyone know how to do this?

    I just checked the Previous System Folder, Library. I don't have a Sounds folder
    Sounds like you checked the HD/Library directory. Check the Home/Library folder? You should have a Sounds folder. At least in 10.5.6 there is one. Your system info confirms you are still using 10.5.2. Have you considered updating?
    I just checked the sounds in Mail Preferences and I do not have the swoosh sound listed as an option to choose. I listened to them all & none of them makes a swoosh sound. Perhaps that sound is not included in os 10.5.6.
    If the swoosh sound is not in your Home directory, search the net for the swoosh sound (email sounds), install to your desktop, then move it to the Home directory sound folder.
    Go to Mail Preferences/General, select New Mail Sound and from the drop down window select Add. Select your sound.
    Repair permissions and restart your computer. Send some mail to yourself to make sure your mail alert is working properly.

  • How to remove text from photo only one layer?

    How do I remove text from this photo? plz & ty
    o I remove text from a photo?

    Contact the person who took the photo and ask for a clean copy.
    If you don't know the photographer, chances are good that your use of the photo would be a violation of copyright.

  • How to remove text from JTable ...........

    AOA
    How to remove the text from cells of JPanel. Just to refresh the GUI.
    regards

    How to provide meaningful subject?
    The subject of this thread does not match what you are asking in the body.
    To set the value of a cell in a JTable, you can simply call setValueAt().
    Read the API to find the method parameters.

  • How to Remove Text From Strings ?

    Hi,
    The question I have is, in the String that I have Pasted below, how can I remove the first line (>gi|23821530|dbj||SEG_D10989S Bos taurus gene for endothelin receptor) and then use the remainder of the text to Post to a web server?
    I have tried doing this with a Regex (Pattern P = Pattern.compile("(^>.*)");), I'm able to capture the first line of text, but am not sure how to remove it and then use the rest of the text to Post to the web server.
    Any Help with this would be much appreciated
    gi|23821530|dbj||SEG_D10989S Bos taurus gene for endothelin receptorGGGATCCCGAGCAAACTGCGGAGGCCACACTGTCAGGCATTCCCTCGGCGTTTCGTCAGAGCCAGACCCT
    CCCGCTGCTGAAGGGAGGCGCGCTCTGCTCCCGGGCTGCCGGGAACCCAGCCGCGCGCCGGGGAAGGAGG
    TCCCTGCCTGGTGCGTCCGGACCAAGAGGTAACCGTTCTGCTTGGTGTTTAATTCAAATCTGTGATTGAA
    CCTTATCCTGGGGCTTCAGTTTGGATTACTTCTTAGGTTTGTTTTTGTTTGTTTGTTTGTTTTTTAACCT
    GTAGCTACAGCAGATTAAAATGGGATTGGAGTGAAGGAGAGGGCTTGAGTGTCTGAAGTCACTCGAAGGG
    GATAGAAACTTCCGAGTTAATCCAGATAGAGACTCTTCCAAATAGACCAAGTGGAGATGTCCGGGAGATT
    TTCCGAGTCAGCCGGCTCAGTCCTGGGGTGTGTGTATGGGGGGTGGGGGCGGTGCCGAAGAGCGGAAGGA
    AGGGGTCTGAAAGTCCAGACATGCGGCATCCGGGGTTGCTGTGGAGTCGAAAGCAGAGACTGGCGATGCC
    CTTGATCTCTAACCTGCCTTGATTTGCCCCGTCCCCGCGCGCCCTTGGCCAGAACGAATACTGCTCCCTC
    TGCGCACACCAGGAGCTCAAAGCTTTGCTTTGGACACCCGTCCTCTCCTCCCCGTCACACCCCTTCCAGG

    String foo = "gi|23821530|dbj||SEG_D10989S Bos taurus
    gene for endothelin receptor";
    String totalString = "gi|23821530|dbj||SEG_D10989S Bos
    taurus gene for endothelin receptor
    GGGATCCCGAGCAAACTGCGGAGGCCACACTGTCAGGCATTCCCTCGGCGTTTCG
    CAGAGCCAGACCCT
    CCCGCTGCTGAAGGGAGGCGCGCTCTGCTCCCGGGCTGCCGGGAACCCAGCCGCG
    GCCGGGGAAGGAGG
    TCCCTGCCTGGTGCGTCCGGACCAAGAGGTAACCGTTCTGCTTGGTGTTTAATTC
    AATCTGTGATTGAA
    CCTTATCCTGGGGCTTCAGTTTGGATTACTTCTTAGGTTTGTTTTTGTTTGTTTG
    TTGTTTTTTAACCT
    GTAGCTACAGCAGATTAAAATGGGATTGGAGTGAAGGAGAGGGCTTGAGTGTCTG
    AGTCACTCGAAGGG
    GATAGAAACTTCCGAGTTAATCCAGATAGAGACTCTTCCAAATAGACCAAGTGGA
    ATGTCCGGGAGATT
    TTCCGAGTCAGCCGGCTCAGTCCTGGGGTGTGTGTATGGGGGGTGGGGGCGGTGC
    GAAGAGCGGAAGGA
    AGGGGTCTGAAAGTCCAGACATGCGGCATCCGGGGTTGCTGTGGAGTCGAAAGCA
    AGACTGGCGATGCC
    CTTGATCTCTAACCTGCCTTGATTTGCCCCGTCCCCGCGCGCCCTTGGCCAGAAC
    AATACTGCTCCCTC
    TGCGCACACCAGGAGCTCAAAGCTTTGCTTTGGACACCCGTCCTCTCCTCCCCGT
    ACACCCCTTCCAGG";
    int position = -1;
    int lenght = -1;
    position = totalString.indexOf(foo) + foo.length();
    String processedString =
    totalString.substring(position);
    Thanks for the post,
    Did the job perfectly!
    cheers again

  • How to have texts sent to email

    How do I have undelivered texts sent to email ? I don't have cell service at home, don't receive texts.

    You cannot.

  • How to remove text

    I have added a piece of text to a movie I am making. How do I remove it?

    99
    I am strictly an Elements Windows user, but I think that we can meet on common ground between Windows and Mac on this.
    From your description, it sounds like all the work was done in the Quick workspace. The screenshots to follow reflect that. If not the case, then more details, and I will adjust the details accordingly.
    After you have created your text "circle" file, be sure to close the Titler.
    The right click the text "circle" file in the Filmstrip spot, and select Delete and Close Gap.
    Please let us know if that worked for you.
    Also, speaking of circles in the Titler
    ATR Premiere Elements Troubleshooting: PE11: Titler Shapes For Highlighting
    ATR

  • How to remove text box that appears with a red pin in maps?

    In Apple maps, when I type in an address, it comes up on the map with the address in a text box and a red pin below it.  I've read that you need to delete the address in search to get rid of the red pin.  I want to get rid of the text box so I can see the map around the address I am searching. The text box blocks a lot of the area if you are trying to discern where on a street this address is, etc.   How can I do this?
    thank you,
    Michelle

    Thanks for the idea.  I did it as far as it would go and it is actually covering the area I'm trying to see.
    Knowing that if I clear the search, the area is visible.  However, when I tried it and did some adjustments to the app, changing they view, it jumped back to my home address so I had to start over.  I assumed there was a way to keep the pin so I don't lose my location and clear the text box as we don't need to keep seeing it as it is up in the info bar.  It sounds like this is not designed into the app.
    Thanks for the suggestion.
    Michelle

  • How to remove text from mp4 video

    hi all,
    i have a mp4 video of 30 seconds.
    the video has a text appearing on left side and bottom of the video.
    i want to remove that text using premiere but im very new to video editing.
    any steps of "how to do" or guidance will be great help.
    thanks

    Sharma,
    While not easy in the best of circumstances, depending on what you have, and what you need to do, there are some possibilities, and one might help.
    First, I would attach a screen-cap of the that Video. You might need to post a couple, if things change dramatically in the Frame. No promises, but there might be some options.
    However, if you can take Jim's suggestion, and get the footage without the Text, things will be so much easier.
    Also, do you have access to Adobe After Effects?
    How about Photoshohop Extended, CS 6, or CC?
    If it cannot be done in PrPro (fewer Tools to employ), it might be possible in AE, or Ps (through Rotoscoping).
    Let us see what you have, and someone will try to help, though remember that the answer might be just as CC_Merchant says, "No."
    Good luck,
    Hunt

  • How to remove text without changing background

    Hey there,
    I'm having an issue. I need to remove the text saying "A Innland", but the background isn't quite the same at all points - the further right you go, the lighter it becomes. How would I go on about removing this?
    The text is ingrained in the picture, it's originally not a photoshop file with a text layer on top.
    I am using Photoshop CS6.
    Thank you in advance!

    Here's another way.
    Press M for Rectangular Marquee Tool and select a strip of gradient above "INNLAND".
    Press Cmd+T for Free Transform and stretch downwards to cover the type.
    Do the same procedure to cover the "A".

  • How to remove text without destroying the picture?

    I am new in photoshop and I am trying to remove the text down of the picture so that I can add another one.
    Is watermark, I have seen sosme videos on Youtube but seems didn't work so well to me.
    If someone can help how to do delete that text and add another one similar with it I would really appreciate it.
    Thanks in advantage

    Contact the owner of the copyright for permission to use without the watermark.

  • How to remove text while restoring the background pattern ?

    Hello everyone,
    I'm trying to remove the text in the following picture and to restore/interplate what the background pattern should be.
    I tried with the clone stamp tool but its taking a long time and I obtain poor results.
    Is there a quick and easy way to have PS do it automatically ?
    Any help appreciated!
    Cheers
    JF

    Here's something to try:
    1.  Choose the Magic Wand selection tool in the Tools panel.
    2.  Set the Tolerance pretty high - e.g., 50 - and uncheck [  ] Contiguous.
    3.  Click the tool in a black letter.
    4.  Select - Expand, e.g., 3 pixels.
    5.  Edit - Fill - Content Aware.
    It won't be perfect, but you can tidy up the parts that aren't fairly directly...
    -Noel

  • How to remove Gmail "sent message" label

    Hi all,
    I am using Lion in one of my Mac and I found one problem
    I am using my Gmail account in Lion Mail
    When I use Lion Mail to send/reply a mail, Gmail on brower will show a "sent message" label on that mail.
    What should I do to prevent it?
    I mean I do not want to see the "sent message" label on browser, after I sent a mail using Lion Mail.
    Thank you !!

    For anyone who has the same trouble, I foudn a soliution here:
    http://lifehacker.com/5555291/how-make-gmail-play-nicely-with-your-desktop-email -client
    Simply three steps repeated here:
    (1) click on a folder "Sent Mail" under [Gmail] and go to the Mailbox menu in the menu bar. Hover over "Use This Mailbox For" and click Sent. This will make Apple Mail use Gmail's Sent Mail folder for sent messages instead of creating its own.
    (2) A label called "Sent Messages" will show up with your other custom labels.
    (3) Drag all the messages from the "Sent Messages" label to the "Sent Mail" label, to make sure they're all there
    (4) You can then delete the "Sent Messages" label.

Maybe you are looking for