How to remove text without changing background

Hey there,
I'm having an issue. I need to remove the text saying "A Innland", but the background isn't quite the same at all points - the further right you go, the lighter it becomes. How would I go on about removing this?
The text is ingrained in the picture, it's originally not a photoshop file with a text layer on top.
I am using Photoshop CS6.
Thank you in advance!

Here's another way.
Press M for Rectangular Marquee Tool and select a strip of gradient above "INNLAND".
Press Cmd+T for Free Transform and stretch downwards to cover the type.
Do the same procedure to cover the "A".

Similar Messages

  • How to Remove Duplicates Without Changing Album?

    Hello All,
    I see a lot of topics on how to remove duplicate songs but there is one thing I would like to know if its possible...
    I would like to remove my duplicates but I still want to see the songs as part of the albums. Example: lets say the same song is present in 3 different albums. I would like to remove 2 of them but have them still showing up as part of the 3 albums. This way the albums remain "complete".
    Is there any way to tool available that can do that? Maybe keeping something like a symbolic link in place of the songs that were deleted?
    Any help would be appreciated.
    Thanks!

    Not possible and has been asked before.
    MJ

  • How to remove text without destroying the picture?

    I am new in photoshop and I am trying to remove the text down of the picture so that I can add another one.
    Is watermark, I have seen sosme videos on Youtube but seems didn't work so well to me.
    If someone can help how to do delete that text and add another one similar with it I would really appreciate it.
    Thanks in advantage

    Contact the owner of the copyright for permission to use without the watermark.

  • How to remove text from .swf animation?

    how to remove text from .swf animation? Can no find this text
    in fla file. Flash 8.

    exactly what 'text' are you referring to? text that you typed
    on the Stage using the 'textTool'? simply select the text with the
    'arrowTool' and hit delete.
    If you are referring to a textField that you want to
    eliminate after a certain amount of time, within your animation
    sequence. first copy the text, create a new layer, paste the text
    in place, then where you want to have the text 'disappear' insert a
    'blank keyframe' at that point in the text layer.
    OR place the textfield within a MC and remove it with code.
    OR if the text is dynamic and you wish to use the position at a
    later time, pass a value of null or and empty string to the field
    at the point you wish. And there are other ways still. :) hope one
    of these works for you.

  • How to remove Yahoo astra Tree Background Colour

    Iam using Yahoo astra Tree Component . How to remove Tree Background colour .

    You could look thru the properties/styles of the component to see if there is something that can be set/changed for the background.  An alternative could be to try editing the compoent in the library.

  • How to remove text from photo only one layer?

    How do I remove text from this photo? plz & ty
    o I remove text from a photo?

    Contact the person who took the photo and ask for a clean copy.
    If you don't know the photographer, chances are good that your use of the photo would be a violation of copyright.

  • How to remove text from JTable ...........

    AOA
    How to remove the text from cells of JPanel. Just to refresh the GUI.
    regards

    How to provide meaningful subject?
    The subject of this thread does not match what you are asking in the body.
    To set the value of a cell in a JTable, you can simply call setValueAt().
    Read the API to find the method parameters.

  • How to Remove Text From Strings ?

    Hi,
    The question I have is, in the String that I have Pasted below, how can I remove the first line (>gi|23821530|dbj||SEG_D10989S Bos taurus gene for endothelin receptor) and then use the remainder of the text to Post to a web server?
    I have tried doing this with a Regex (Pattern P = Pattern.compile("(^>.*)");), I'm able to capture the first line of text, but am not sure how to remove it and then use the rest of the text to Post to the web server.
    Any Help with this would be much appreciated
    gi|23821530|dbj||SEG_D10989S Bos taurus gene for endothelin receptorGGGATCCCGAGCAAACTGCGGAGGCCACACTGTCAGGCATTCCCTCGGCGTTTCGTCAGAGCCAGACCCT
    CCCGCTGCTGAAGGGAGGCGCGCTCTGCTCCCGGGCTGCCGGGAACCCAGCCGCGCGCCGGGGAAGGAGG
    TCCCTGCCTGGTGCGTCCGGACCAAGAGGTAACCGTTCTGCTTGGTGTTTAATTCAAATCTGTGATTGAA
    CCTTATCCTGGGGCTTCAGTTTGGATTACTTCTTAGGTTTGTTTTTGTTTGTTTGTTTGTTTTTTAACCT
    GTAGCTACAGCAGATTAAAATGGGATTGGAGTGAAGGAGAGGGCTTGAGTGTCTGAAGTCACTCGAAGGG
    GATAGAAACTTCCGAGTTAATCCAGATAGAGACTCTTCCAAATAGACCAAGTGGAGATGTCCGGGAGATT
    TTCCGAGTCAGCCGGCTCAGTCCTGGGGTGTGTGTATGGGGGGTGGGGGCGGTGCCGAAGAGCGGAAGGA
    AGGGGTCTGAAAGTCCAGACATGCGGCATCCGGGGTTGCTGTGGAGTCGAAAGCAGAGACTGGCGATGCC
    CTTGATCTCTAACCTGCCTTGATTTGCCCCGTCCCCGCGCGCCCTTGGCCAGAACGAATACTGCTCCCTC
    TGCGCACACCAGGAGCTCAAAGCTTTGCTTTGGACACCCGTCCTCTCCTCCCCGTCACACCCCTTCCAGG

    String foo = "gi|23821530|dbj||SEG_D10989S Bos taurus
    gene for endothelin receptor";
    String totalString = "gi|23821530|dbj||SEG_D10989S Bos
    taurus gene for endothelin receptor
    GGGATCCCGAGCAAACTGCGGAGGCCACACTGTCAGGCATTCCCTCGGCGTTTCG
    CAGAGCCAGACCCT
    CCCGCTGCTGAAGGGAGGCGCGCTCTGCTCCCGGGCTGCCGGGAACCCAGCCGCG
    GCCGGGGAAGGAGG
    TCCCTGCCTGGTGCGTCCGGACCAAGAGGTAACCGTTCTGCTTGGTGTTTAATTC
    AATCTGTGATTGAA
    CCTTATCCTGGGGCTTCAGTTTGGATTACTTCTTAGGTTTGTTTTTGTTTGTTTG
    TTGTTTTTTAACCT
    GTAGCTACAGCAGATTAAAATGGGATTGGAGTGAAGGAGAGGGCTTGAGTGTCTG
    AGTCACTCGAAGGG
    GATAGAAACTTCCGAGTTAATCCAGATAGAGACTCTTCCAAATAGACCAAGTGGA
    ATGTCCGGGAGATT
    TTCCGAGTCAGCCGGCTCAGTCCTGGGGTGTGTGTATGGGGGGTGGGGGCGGTGC
    GAAGAGCGGAAGGA
    AGGGGTCTGAAAGTCCAGACATGCGGCATCCGGGGTTGCTGTGGAGTCGAAAGCA
    AGACTGGCGATGCC
    CTTGATCTCTAACCTGCCTTGATTTGCCCCGTCCCCGCGCGCCCTTGGCCAGAAC
    AATACTGCTCCCTC
    TGCGCACACCAGGAGCTCAAAGCTTTGCTTTGGACACCCGTCCTCTCCTCCCCGT
    ACACCCCTTCCAGG";
    int position = -1;
    int lenght = -1;
    position = totalString.indexOf(foo) + foo.length();
    String processedString =
    totalString.substring(position);
    Thanks for the post,
    Did the job perfectly!
    cheers again

  • Clusters: How to remove the 3D shaded background?

    I'm currently building an automated test and cal setup using labview. Here I have loads of input fields and indicators that causes a sea of variables. That sea has now turned into an overwhelming ocean that is anoying to rok with. Whenever I insert a local varable has to slect which item the var should point to the list is two screen heigths long. To avoid this I've decided to group them in clusters. however hee I've encountered something very anoying: I do not want the 3D shading (like a an engraved area) around my fields that make up the cluster. Howe do I make a plain background? I've looked everywhere (at leat that's what I think) but can't find out how to change it. I refuse to believe that I have to settle with
    an ugly layout with loads of ingoing shaded boxes around my fields.
    Hope that somebody outthere can help me.
    Cheers,
    Martin

    Use the cluster container from the clasic palette and make the border transparent.
    See attached.
    Ben
    Ben Rayner
    Certified LabVIEW Developer
    www.DSAutomation.com
    Ben Rayner
    I am currently active on.. MainStream Preppers
    Rayner's Ridge is under construction
    Attachments:
    Cluster_no_border.vi ‏9 KB

  • I have an Iphone 4s and mini ipad..I downloaded the app, vz messages..I cannot personalize my texts, fonts, change backgrounds and ringtones????

    I have an Iphone 4S and mini ipad.  I download the app, vz messages...I cannot personalize my texts..change fonts, backgrounds and ringtones..Why not?

    Gina your post was very helpful to me as well. I recently Traded In my Apple IPad 3 WIFI Only Device for a Verizon Wireless Apple IPad Mini Pre-Order. This is actually my very first WIFI + Cellular IPad Purchase. The Price was Finally Affordable.

  • How to remove text while restoring the background pattern ?

    Hello everyone,
    I'm trying to remove the text in the following picture and to restore/interplate what the background pattern should be.
    I tried with the clone stamp tool but its taking a long time and I obtain poor results.
    Is there a quick and easy way to have PS do it automatically ?
    Any help appreciated!
    Cheers
    JF

    Here's something to try:
    1.  Choose the Magic Wand selection tool in the Tools panel.
    2.  Set the Tolerance pretty high - e.g., 50 - and uncheck [  ] Contiguous.
    3.  Click the tool in a black letter.
    4.  Select - Expand, e.g., 3 pixels.
    5.  Edit - Fill - Content Aware.
    It won't be perfect, but you can tidy up the parts that aren't fairly directly...
    -Noel

  • Help - how can I remove text in the background?

    I am translating a text from English into Portuguese in a document created in Germany (as .mif 7).
    After I inserted the Portuguese text, a ruler and the words "498 Entwurf 15.06.2011" in red and "Abstand" in sky blue started to appear in the background, as well as some kind of a grid (please see attached image). I need them to disappear when the document is printed, but I haven't been able to make them disappear so far. The words in red indicate the name of the document (498) and the date when it was originally created. I need the document to have a white background only with the letters in black and images (just like the original, but in Portuguese - no words in sky blue and red and no grid).
    This is probably easy to solve and I may sound really silly, but I've already lost 3 hours and I'm getting desperate because I need to deliver the document as soon as possible.
    Any help would be much appreciated.
    Best,
    Paulo Rodrigues

    Hi,
    I think the converter you are using to convert it to portuguese is a free converter and it has been noticed that when you use the free or trial version of any converter ,it generally puts its name in the PDF document and you have to buy that product to get rid of it.If thats true then we would not be able to remove that text.
    Kindly let me know if thats correct what i said.
    Thanks
    Harpreet.

  • How do i replace text without changing the format?

    also, how do i replace a photo with a new one?

    If the text is live, you can double click on the thumbnail and it will select the text. At that point you can type in the new text.
    As for the photo, that depends on the document. It can be as simple as closing the document and opening the next image.
    If the image is on its own layer, you could just delete the layer or if you want to preserve the style asociated with it, you could use selection tools and delete the image, then place or paste the new image in its place.
    If it is part of a collage, you may want to convert the image(s) to a smart object. Then in the layers submenu, you can choose to replace the image.
    The advantage of the smart object is it will remember the scale of the image.

  • Slowing text scroll without changing background clip length?

    I have an intro to my movie that uses a sound clip from a song.  The sound clip is 30 seconds long, so my video clip must be 30 sec long (the sound actually carries over into my next clip).  I am using the text scroll to flash the title and a quotation onto the screen, but I want it to move at about half the speed it currently is. 
    I have tried slow motion but that doesn't work.  I have also added lots of spaces between lines but it still moves faster than I want.  So is there anyway we can slow that text scroll down to a reasonable speed?
    Thanks in advance
    Pat

    drag the ends of the Title to the length of the clip.
    If this is still too fast, remember 6th grade:
    speed = length + time
    if there's not enough time, it can not get any slower

  • How to remove text from mp4 video

    hi all,
    i have a mp4 video of 30 seconds.
    the video has a text appearing on left side and bottom of the video.
    i want to remove that text using premiere but im very new to video editing.
    any steps of "how to do" or guidance will be great help.
    thanks

    Sharma,
    While not easy in the best of circumstances, depending on what you have, and what you need to do, there are some possibilities, and one might help.
    First, I would attach a screen-cap of the that Video. You might need to post a couple, if things change dramatically in the Frame. No promises, but there might be some options.
    However, if you can take Jim's suggestion, and get the footage without the Text, things will be so much easier.
    Also, do you have access to Adobe After Effects?
    How about Photoshohop Extended, CS 6, or CC?
    If it cannot be done in PrPro (fewer Tools to employ), it might be possible in AE, or Ps (through Rotoscoping).
    Let us see what you have, and someone will try to help, though remember that the answer might be just as CC_Merchant says, "No."
    Good luck,
    Hunt

Maybe you are looking for