How to remove text

I have added a piece of text to a movie I am making. How do I remove it?

99
I am strictly an Elements Windows user, but I think that we can meet on common ground between Windows and Mac on this.
From your description, it sounds like all the work was done in the Quick workspace. The screenshots to follow reflect that. If not the case, then more details, and I will adjust the details accordingly.
After you have created your text "circle" file, be sure to close the Titler.
The right click the text "circle" file in the Filmstrip spot, and select Delete and Close Gap.
Please let us know if that worked for you.
Also, speaking of circles in the Titler
ATR Premiere Elements Troubleshooting: PE11: Titler Shapes For Highlighting
ATR

Similar Messages

How to remove text from .swf animation?

how to remove text from .swf animation? Can no find this text
in fla file. Flash 8.

exactly what 'text' are you referring to? text that you typed
on the Stage using the 'textTool'? simply select the text with the
'arrowTool' and hit delete.
If you are referring to a textField that you want to
eliminate after a certain amount of time, within your animation
sequence. first copy the text, create a new layer, paste the text
in place, then where you want to have the text 'disappear' insert a
'blank keyframe' at that point in the text layer.
OR place the textfield within a MC and remove it with code.
OR if the text is dynamic and you wish to use the position at a
later time, pass a value of null or and empty string to the field
at the point you wish. And there are other ways still. :) hope one
of these works for you.

How to remove text from photo only one layer?

How do I remove text from this photo? plz & ty
o I remove text from a photo?

Contact the person who took the photo and ask for a clean copy.
If you don't know the photographer, chances are good that your use of the photo would be a violation of copyright.

How to remove text from JTable ...........

AOA
How to remove the text from cells of JPanel. Just to refresh the GUI.
regards

How to provide meaningful subject?
The subject of this thread does not match what you are asking in the body.
To set the value of a cell in a JTable, you can simply call setValueAt().
Read the API to find the method parameters.

How to Remove Text From Strings ?

Hi,
The question I have is, in the String that I have Pasted below, how can I remove the first line (>gi|23821530|dbj||SEG_D10989S Bos taurus gene for endothelin receptor) and then use the remainder of the text to Post to a web server?
I have tried doing this with a Regex (Pattern P = Pattern.compile("(^>.*)");), I'm able to capture the first line of text, but am not sure how to remove it and then use the rest of the text to Post to the web server.
Any Help with this would be much appreciated
gi|23821530|dbj||SEG_D10989S Bos taurus gene for endothelin receptorGGGATCCCGAGCAAACTGCGGAGGCCACACTGTCAGGCATTCCCTCGGCGTTTCGTCAGAGCCAGACCCT
CCCGCTGCTGAAGGGAGGCGCGCTCTGCTCCCGGGCTGCCGGGAACCCAGCCGCGCGCCGGGGAAGGAGG
TCCCTGCCTGGTGCGTCCGGACCAAGAGGTAACCGTTCTGCTTGGTGTTTAATTCAAATCTGTGATTGAA
CCTTATCCTGGGGCTTCAGTTTGGATTACTTCTTAGGTTTGTTTTTGTTTGTTTGTTTGTTTTTTAACCT
GTAGCTACAGCAGATTAAAATGGGATTGGAGTGAAGGAGAGGGCTTGAGTGTCTGAAGTCACTCGAAGGG
GATAGAAACTTCCGAGTTAATCCAGATAGAGACTCTTCCAAATAGACCAAGTGGAGATGTCCGGGAGATT
TTCCGAGTCAGCCGGCTCAGTCCTGGGGTGTGTGTATGGGGGGTGGGGGCGGTGCCGAAGAGCGGAAGGA
AGGGGTCTGAAAGTCCAGACATGCGGCATCCGGGGTTGCTGTGGAGTCGAAAGCAGAGACTGGCGATGCC
CTTGATCTCTAACCTGCCTTGATTTGCCCCGTCCCCGCGCGCCCTTGGCCAGAACGAATACTGCTCCCTC
TGCGCACACCAGGAGCTCAAAGCTTTGCTTTGGACACCCGTCCTCTCCTCCCCGTCACACCCCTTCCAGG

String foo = "gi|23821530|dbj||SEG_D10989S Bos taurus
gene for endothelin receptor";
String totalString = "gi|23821530|dbj||SEG_D10989S Bos
taurus gene for endothelin receptor
GGGATCCCGAGCAAACTGCGGAGGCCACACTGTCAGGCATTCCCTCGGCGTTTCG
CAGAGCCAGACCCT
CCCGCTGCTGAAGGGAGGCGCGCTCTGCTCCCGGGCTGCCGGGAACCCAGCCGCG
GCCGGGGAAGGAGG
TCCCTGCCTGGTGCGTCCGGACCAAGAGGTAACCGTTCTGCTTGGTGTTTAATTC
AATCTGTGATTGAA
CCTTATCCTGGGGCTTCAGTTTGGATTACTTCTTAGGTTTGTTTTTGTTTGTTTG
TTGTTTTTTAACCT
GTAGCTACAGCAGATTAAAATGGGATTGGAGTGAAGGAGAGGGCTTGAGTGTCTG
AGTCACTCGAAGGG
GATAGAAACTTCCGAGTTAATCCAGATAGAGACTCTTCCAAATAGACCAAGTGGA
ATGTCCGGGAGATT
TTCCGAGTCAGCCGGCTCAGTCCTGGGGTGTGTGTATGGGGGGTGGGGGCGGTGC
GAAGAGCGGAAGGA
AGGGGTCTGAAAGTCCAGACATGCGGCATCCGGGGTTGCTGTGGAGTCGAAAGCA
AGACTGGCGATGCC
CTTGATCTCTAACCTGCCTTGATTTGCCCCGTCCCCGCGCGCCCTTGGCCAGAAC
AATACTGCTCCCTC
TGCGCACACCAGGAGCTCAAAGCTTTGCTTTGGACACCCGTCCTCTCCTCCCCGT
ACACCCCTTCCAGG";
int position = -1;
int lenght = -1;
position = totalString.indexOf(foo) + foo.length();
String processedString =
totalString.substring(position);
Thanks for the post,
Did the job perfectly!
cheers again

How to remove text from mp4 video

hi all,
i have a mp4 video of 30 seconds.
the video has a text appearing on left side and bottom of the video.
i want to remove that text using premiere but im very new to video editing.
any steps of "how to do" or guidance will be great help.
thanks

Sharma,
While not easy in the best of circumstances, depending on what you have, and what you need to do, there are some possibilities, and one might help.
First, I would attach a screen-cap of the that Video. You might need to post a couple, if things change dramatically in the Frame. No promises, but there might be some options.
However, if you can take Jim's suggestion, and get the footage without the Text, things will be so much easier.
Also, do you have access to Adobe After Effects?
How about Photoshohop Extended, CS 6, or CC?
If it cannot be done in PrPro (fewer Tools to employ), it might be possible in AE, or Ps (through Rotoscoping).
Let us see what you have, and someone will try to help, though remember that the answer might be just as CC_Merchant says, "No."
Good luck,
Hunt

How to remove text without changing background

Hey there,
I'm having an issue. I need to remove the text saying "A Innland", but the background isn't quite the same at all points - the further right you go, the lighter it becomes. How would I go on about removing this?
The text is ingrained in the picture, it's originally not a photoshop file with a text layer on top.
I am using Photoshop CS6.
Thank you in advance!

Here's another way.
Press M for Rectangular Marquee Tool and select a strip of gradient above "INNLAND".
Press Cmd+T for Free Transform and stretch downwards to cover the type.
Do the same procedure to cover the "A".

How to remove text without destroying the picture?

I am new in photoshop and I am trying to remove the text down of the picture so that I can add another one.
Is watermark, I have seen sosme videos on Youtube but seems didn't work so well to me.
If someone can help how to do delete that text and add another one similar with it I would really appreciate it.
Thanks in advantage

Contact the owner of the copyright for permission to use without the watermark.

How to remove text box that appears with a red pin in maps?

In Apple maps, when I type in an address, it comes up on the map with the address in a text box and a red pin below it. I've read that you need to delete the address in search to get rid of the red pin. I want to get rid of the text box so I can see the map around the address I am searching. The text box blocks a lot of the area if you are trying to discern where on a street this address is, etc. How can I do this?
thank you,
Michelle

Thanks for the idea. I did it as far as it would go and it is actually covering the area I'm trying to see.
Knowing that if I clear the search, the area is visible. However, when I tried it and did some adjustments to the app, changing they view, it jumped back to my home address so I had to start over. I assumed there was a way to keep the pin so I don't lose my location and clear the text box as we don't need to keep seeing it as it is up in the info bar. It sounds like this is not designed into the app.
Thanks for the suggestion.
Michelle

How to remove text sent swoosh sound?

When I send a text I see/hear this annoying swoosh sound when it is sending the text. My sound seeting are none and I do not want to have my iphone in silence or vibrate is it possible to remove that swoosh sound when text sent?

Tell Apple:
http://www.apple.com/feedback/iphone.html

How to remove text while restoring the background pattern ?

Hello everyone,
I'm trying to remove the text in the following picture and to restore/interplate what the background pattern should be.
I tried with the clone stamp tool but its taking a long time and I obtain poor results.
Is there a quick and easy way to have PS do it automatically ?
Any help appreciated!
Cheers
JF

Here's something to try:
1. Choose the Magic Wand selection tool in the Tools panel.
2. Set the Tolerance pretty high - e.g., 50 - and uncheck [ ] Contiguous.
3. Click the tool in a black letter.
4. Select - Expand, e.g., 3 pixels.
5. Edit - Fill - Content Aware.
It won't be perfect, but you can tidy up the parts that aren't fairly directly...
-Noel

E5: how to remove text to speech.......so that my ...

finnish _stub.sis.............1680bytes.
finnish-kimmo-stub.sis.............2028bytes
location:Z /system/install.....
plz provide me link for apps to remove this is unwanted for me
THANK for nokia team support..............
Solved!
Go to Solution.

No the apps won't harm your card if you download from Nokia store. But use the apps that you want the most. Don't overload your card because this may slow down your phone. Hope this helps you.
Nokia C7

Help with removing text from background

Hi,
I'm pretty new to this, but I'm trying to figure out how to remove text from a background. My problem is that when I use tools to grab the text, it only selects part of it because the pixels of the text are actually different colors as it blends in with the backgorund. Does anyone have a quick idea how to do this?
Thanks
<link removed>

Don't you like to see people's websites/projects/works in forums? Seems to me that you get to know people and what they are into when they post their work. Anyways in the spirit of you helping me, here is the picture.
I'm trying to remove the letters from the background. Everything about the letters including the shadows.
Thanks

Removing text in RH that is conditionalized using attributes in FM

I use TCS 1 (FM8 (structured) + RH7).
Does anyone know how to remove text in RH that was conditionalized in FM using attributes?
The filter works perfect in FM - text is removed, but it is still present when the FM files are imported into RH.

Hi there
Sorry for the delay in replying. I've been trying to make this work and it just doesn't want to!
So here is a thought. You are able to make the border surrounding and highlighting the image show and hide on the mouse click. I'm doing that using a Positioned Text Box. My thought here is that you could use these to layer in images that also have the descriptive text as part of the image or maybe even inside the Positioned Text Box. I'm thinking that would work.
Please note that the DHTML Hide/Show functionality is far from being remotely close to "cross browser". It works in IE, but not in Firefox. At least on my own PC here.
Cheers... Rick
Helpful and Handy Links
RoboHelp Wish Form/Bug Reporting Form
Begin learning RoboHelp HTML within the day - $24.95!
Adobe Certified RoboHelp HTML Training
SorcerStone Blog
RoboHelp eBooks

Help! Trying to remove text from an already saved image

I accidently saved an image with my watermark & now the image is locked & also saved as a jpeg image. I can't remove the text without stamping it out or just starting over. Does anyone know how to remove text from an image that has already been saved?

You could have saved it before closing the image. As long as the image is open in Editor, we can always go back to the original position and get back the original file.
In case you have closed, check if you have saved it as a version set. If your file name contains "edited-1" something, you have the file preserved.
Otherwise, if you have replaced the file without having any copy of it anywhere else, you cannot revert the changes.

How to remove text

Similar Messages

Maybe you are looking for