Tidying up XML produced using Jtidy
I am not very experienced in the use of java XML libraries but thanks to some great suggestions from members of this forum i have had a headstart but are now stock on the following problem: (my object is mainly to get data from a web page)
I have used the JTidy example provided on the website to convert a webpage from which i want to get data into an XML file on my local harddisk.
Now, when i try getting the data with an XSL file using the local xml file as the source, the Xalan transformer complains and spits out errors in the XML file.
Is there any way i could clean the xml file so that it becomes well formed, thus enabling me to use XSL to get the data i desire?
Any suggestions will be much appreciated.
P/s: I tried changing the setting of the output in Jtidy from tidy.setXmlOut(true) to tidy.setXHTML(true) all to no avail!
Are you saying that JTidy produces XML that is not
well-formed, or are you just guessing because you
don't understand the error messages?Propably i am saying that because i don't understand the error messages. But the problem is that when i use a different xml file, the transformatiom works!
The code used for the transformation of the XML file after being parsed by Jtidy is as follows:
public class SimpleTransform
public static void main(String[] args)
throws TransformerException, TransformerConfigurationException,
FileNotFoundException, IOException
TransformerFactory tFactory = TransformerFactory.newInstance();
// Use the TransformerFactory to instantiate a Transformer that will work with
// the specfied stylesheet. This method call also processes the stylesheet
// into a compiled Templates object.
Transformer transformer = tFactory.newTransformer(new StreamSource("outPut_to_xml.xsl"));
// Use the Transformer to apply the associated Templates object to an XML document
// and write the output to a file
transformer.transform(new StreamSource("outPut_to_xml.xml"), new StreamResult(new FileOutputStream("metoerrrtest.txt")));
System.out.println("************* The result is in metoerrrtest.txt*************");
}The error i get is as follows:
-//W3C//DTD HTML 4.01 Transitional//EN; Line #31; Column #3; The declaration for the entity "HTML.Version" must end with '>'.
BUILD SUCCESSFUL (total time: 1 second)
Similar Messages
-
The XML page cannot be displayed Cannot view XML input using XSL stylesheet
Hi Oracle Gurus,
I got this error ...once i have submitted request it shows warning ..I opened output it shows the below error...i cant understand how to resolve this error...Please help me...It is PL/SQ L STORED PROCEDURE CODE...
The XML page cannot be displayed
Cannot view XML input using XSL style sheet. Please correct the error and then click the Refresh button, or try again later.
A semi colon character was expected. Error processing resource 'http://orappsus64.tsindia.in:8009/OA_CGI/FNDWRR.exe?temp_id...
<CP_PROJECT>IT/Quintiles/J&J COGNOS</CP_PROJECT>
----------------------------^
n-left:1em;text-indent:-2em"> <GL_MAIN_PERIOD>Jun-12</GL_MAIN_PERIOD>
<TOTAL_REVENUE>4026.14</TOTAL_REVENUE>
<GL_PERIOD>Jun-12</GL_PERIOD>
</G_TOTAL_REVENUE_CAT>
THIS IS MY LOG FILE
[10/1/12 10:44:26 AM] [main] Starting GSF service with concurrent process id = 157635.
[10/1/12 10:44:26 AM] [main] Initialization Parameters: oracle.apps.fnd.cp.opp.OPPServiceThread:2:0:max_threads=5
[10/1/12 10:44:26 AM] [Thread-22] Service thread starting up.
[10/1/12 10:44:26 AM] [Thread-23] Service thread starting up.
[10/1/12 10:52:33 AM] [OPPServiceThread1] Post-processing request 1296337.
[10/1/12 10:52:33 AM] [157635:RT1296337] Executing post-processing actions for request 1296337.
[10/1/12 10:52:34 AM] [157635:RT1296337] Starting XML Publisher post-processing action.
[10/1/12 10:52:34 AM] [157635:RT1296337]
Template code: XXTGSCPR004
Template app: PA
Language: en
Territory: US
Output type: EXCEL
[100112_105234216][][EXCEPTION] [DEBUG] ------- Preferences defined PreferenceStore -------
[100112_105234216][][EXCEPTION] [DEBUG] ------- Environment variables stored in EnvironmentStore -------
[100112_105234216][][EXCEPTION] [DEBUG] [FND_JDBC_IDLE_THRESHOLD.LOW]:[-1]
[100112_105234216][][EXCEPTION] [DEBUG] [SECURITY_GROUP_ID]:[0]
[100112_105234216][][EXCEPTION] [DEBUG] [FND_JDBC_BUFFER_DECAY_INTERVAL]:[300]
[100112_105234217][][EXCEPTION] [DEBUG] [NLS_CHARACTERSET]:[US7ASCII]
[100112_105234217][][EXCEPTION] [DEBUG] [RESP_APPL_ID]:[-1]
[100112_105234217][][EXCEPTION] [DEBUG] [NLS_LANGUAGE]:[AMERICAN]
[100112_105234217][][EXCEPTION] [DEBUG] [FND_JDBC_BUFFER_MIN]:[1]
[100112_105234217][][EXCEPTION] [DEBUG] [FND_JDBC_BUFFER_MAX]:[2]
[100112_105234217][][EXCEPTION] [DEBUG] [NLS_NUMERIC_CHARACTERS]:[.,]
[100112_105234217][][EXCEPTION] [DEBUG] [APPS_JDBC_URL]:[jdbc:oracle:thin:@(DESCRIPTION=(ADDRESS_LIST=(LOAD_BALANCE=YES)(FAILOVER=YES)(ADDRESS=(PROTOCOL=tcp)(HOST=orappsus64.tsindia.in)(PORT=1530)))(CONNECT_DATA=(SID=clone)))]
[100112_105234217][][EXCEPTION] [DEBUG] [RESP_ID]:[-1]
[100112_105234217][][EXCEPTION] [DEBUG] [FND_MAX_JDBC_CONNECTIONS]:[500]
[100112_105234217][][EXCEPTION] [DEBUG] [FND_JDBC_USABLE_CHECK]:[false]
[100112_105234218][][EXCEPTION] [DEBUG] [USER_ID]:[-1]
[100112_105234218][][EXCEPTION] [DEBUG] [NLS_TERRITORY]:[AMERICA]
[100112_105234218][][EXCEPTION] [DEBUG] [FND_JDBC_PLSQL_RESET]:[false]
[100112_105234218][][EXCEPTION] [DEBUG] [FND_JDBC_CONTEXT_CHECK]:[true]
[100112_105234218][][EXCEPTION] [DEBUG] [NLS_DATE_FORMAT]:[DD-MON-RR]
[100112_105234218][][EXCEPTION] [DEBUG] [FND_JDBC_BUFFER_DECAY_SIZE]:[5]
[100112_105234218][][EXCEPTION] [DEBUG] [FND_JDBC_IDLE_THRESHOLD.HIGH]:[-1]
[100112_105234218][][EXCEPTION] [DEBUG] [NLS_SORT]:[BINARY]
[100112_105234218][][EXCEPTION] [DEBUG] [NLS_DATE_LANGUAGE]:[AMERICAN]
[100112_105234218][][EXCEPTION] [DEBUG] [LOGIN_ID]:[-1]
[100112_105234218][][EXCEPTION] [DEBUG] ------- Properties stored in Java System Properties -------
[100112_105234219][][EXCEPTION] [DEBUG] [APPLTMP]:[AP1/oracle/PROD01/inst/apps/clone_orappsus64/appltmp]
[100112_105234219][][EXCEPTION] [DEBUG] [java.runtime.name]:[Java(TM) SE Runtime Environment]
[100112_105234219][][EXCEPTION] [DEBUG] [sun.boot.library.path]:[AP1/oracle/PROD01/apps/tech_st/10.1.3/appsutil/jdk/jre/lib/i386]
[100112_105234219][][EXCEPTION] [DEBUG] [java.vm.version]:[11.0-b15]
[100112_105234219][][EXCEPTION] [DEBUG] [OVERRIDE_DBC]:[true]
[100112_105234219][][EXCEPTION] [DEBUG] [dbcfile]:[AP1/oracle/PROD01/inst/apps/clone_orappsus64/appl/fnd/12.0.0/secure/clone.dbc]
[100112_105234219][][EXCEPTION] [DEBUG] [java.vm.vendor]:[Sun Microsystems Inc.]
[100112_105234219][][EXCEPTION] [DEBUG] [java.vendor.url]:[http://java.sun.com/]
[100112_105234219][][EXCEPTION] [DEBUG] [path.separator]:[:]
[100112_105234219][][EXCEPTION] [DEBUG] [APPLCSF]:[AP1/oracle/PROD01/inst/apps/clone_orappsus64/logs/appl/conc]
[100112_105234220][][EXCEPTION] [DEBUG] [java.vm.name]:[Java HotSpot(TM) Server VM]
[100112_105234220][][EXCEPTION] [DEBUG] [file.encoding.pkg]:[sun.io]
[100112_105234220][][EXCEPTION] [DEBUG] [sun.java.launcher]:[SUN_STANDARD]
[100112_105234220][][EXCEPTION] [DEBUG] [user.country]:[US]
[100112_105234220][][EXCEPTION] [DEBUG] [sun.os.patch.level]:[unknown]
[100112_105234220][][EXCEPTION] [DEBUG] [java.vm.specification.name]:[Java Virtual Machine Specification]
[100112_105234220][][EXCEPTION] [DEBUG] [user.dir]:[AP1/oracle/PROD01/inst/apps/clone_orappsus64/logs/appl/conc/log]
[100112_105234220][][EXCEPTION] [DEBUG] [java.runtime.version]:[1.6.0_10-b33]
[100112_105234220][][EXCEPTION] [DEBUG] [CLIENT_PROCESSID]:[25943]
[100112_105234220][][EXCEPTION] [DEBUG] [java.awt.graphicsenv]:[sun.awt.X11GraphicsEnvironment]
[100112_105234220][][EXCEPTION] [DEBUG] [java.endorsed.dirs]:[AP1/oracle/PROD01/apps/tech_st/10.1.3/appsutil/jdk/jre/lib/endorsed]
[100112_105234221][][EXCEPTION] [DEBUG] [os.arch]:[i386]
[100112_105234221][][EXCEPTION] [DEBUG] [JTFDBCFILE]:[AP1/oracle/PROD01/inst/apps/clone_orappsus64/appl/fnd/12.0.0/secure/clone.dbc]
[100112_105234221][][EXCEPTION] [DEBUG] [java.io.tmpdir]:[tmp]
[100112_105234221][][EXCEPTION] [DEBUG] [line.separator]:[
[100112_105234221][][EXCEPTION] [DEBUG] [java.vm.specification.vendor]:[Sun Microsystems Inc.]
[100112_105234221][][EXCEPTION] [DEBUG] [os.name]:[Linux]
[100112_105234221][][EXCEPTION] [DEBUG] [FND_JDBC_BUFFER_MIN]:[1]
[100112_105234221][][EXCEPTION] [DEBUG] [cpid]:[157635]
[100112_105234221][][EXCEPTION] [DEBUG] [sun.jnu.encoding]:[UTF-8]
[100112_105234221][][EXCEPTION] [DEBUG] [oracle.apps.fnd.common.Pool.leak.mode]:[stderr:off]
[100112_105234221][][EXCEPTION] [DEBUG] [java.library.path]:[AP1/oracle/PROD01/apps/tech_st/10.1.3/appsutil/jdk/jre/lib/i386/server:/AP1/oracle/PROD01/apps/tech_st/10.1.3/appsutil/jdk/jre/lib/i386:/AP1/oracle/PROD01/apps/tech_st/10.1.3/appsutil/jdk/jre/../lib/i386:/AP1/oracle/PROD01/apps/tech_st/10.1.3/lib32:/AP1/oracle/PROD01/apps/tech_st/10.1.3/lib:/AP1/oracle/PROD01/apps/apps_st/appl/cz/12.0.0/bin:/AP1/oracle/PROD01/apps/apps_st/appl/iby/12.0.0/bin:/AP1/oracle/PROD01/apps/apps_st/appl/pon/12.0.0/bin:/AP1/oracle/PROD01/apps/apps_st/appl/sht/12.0.0/lib:/usr/java/packages/lib/i386:/lib:/usr/lib]
[100112_105234222][][EXCEPTION] [DEBUG] [java.specification.name]:[Java Platform API Specification]
[100112_105234222][][EXCEPTION] [DEBUG] [java.class.version]:[50.0]
[100112_105234222][][EXCEPTION] [DEBUG] [sun.management.compiler]:[HotSpot Tiered Compilers]
[100112_105234222][][EXCEPTION] [DEBUG] [queue_appl_id]:[0]
[100112_105234222][][EXCEPTION] [DEBUG] [os.version]:[2.6.18-128.el5]
[100112_105234222][][EXCEPTION] [DEBUG] [LONG_RUNNING_JVM]:[true]
[100112_105234222][][EXCEPTION] [DEBUG] [user.home]:[home/applmgr01]
[100112_105234222][][EXCEPTION] [DEBUG] [user.timezone]:[Asia/Kolkata]
[100112_105234222][][EXCEPTION] [DEBUG] [java.awt.printerjob]:[sun.print.PSPrinterJob]
[100112_105234222][][EXCEPTION] [DEBUG] [file.encoding]:[UTF-8]
[100112_105234222][][EXCEPTION] [DEBUG] [java.specification.version]:[1.6]
[100112_105234222][][EXCEPTION] [DEBUG] [CACHEMODE]:[DISTRIBUTED]
[100112_105234222][][EXCEPTION] [DEBUG] [conc_queue_id]:[6269]
[100112_105234222][][EXCEPTION] [DEBUG] [java.class.path]:[AP1/oracle/PROD01/apps/tech_st/10.1.3/appsutil/jdk/lib/dt.jar:/AP1/oracle/PROD01/apps/tech_st/10.1.3/appsutil/jdk/lib/tools.jar:/AP1/oracle/PROD01/apps/tech_st/10.1.3/appsutil/jdk/jre/lib/rt.jar:/AP1/oracle/PROD01/apps/apps_st/comn/java/lib/appsborg2.zip:/AP1/oracle/PROD01/apps/apps_st/comn/java/classes]
[100112_105234222][][EXCEPTION] [DEBUG] [user.name]:[applmgr01]
[100112_105234222][][EXCEPTION] [DEBUG] [DBCFILE]:[AP1/oracle/PROD01/inst/apps/clone_orappsus64/appl/fnd/12.0.0/secure/clone.dbc]
[100112_105234222][][EXCEPTION] [DEBUG] [java.vm.specification.version]:[1.0]
[100112_105234222][][EXCEPTION] [DEBUG] [java.home]:[AP1/oracle/PROD01/apps/tech_st/10.1.3/appsutil/jdk/jre]
[100112_105234222][][EXCEPTION] [DEBUG] [sun.arch.data.model]:[32]
[100112_105234223][][EXCEPTION] [DEBUG] [user.language]:[en]
[100112_105234223][][EXCEPTION] [DEBUG] [java.specification.vendor]:[Sun Microsystems Inc.]
[100112_105234223][][EXCEPTION] [DEBUG] [java.vm.info]:[mixed mode]
[100112_105234223][][EXCEPTION] [DEBUG] [logfile]:[AP1/oracle/PROD01/inst/apps/clone_orappsus64/logs/appl/conc/log/FNDOPP157635.txt]
[100112_105234223][][EXCEPTION] [DEBUG] [java.version]:[1.6.0_10]
[100112_105234223][][EXCEPTION] [DEBUG] [java.ext.dirs]:[AP1/oracle/PROD01/apps/tech_st/10.1.3/appsutil/jdk/jre/lib/ext:/usr/java/packages/lib/ext]
[100112_105234223][][EXCEPTION] [DEBUG] [sun.boot.class.path]:[AP1/oracle/PROD01/apps/tech_st/10.1.3/appsutil/jdk/jre/lib/resources.jar:/AP1/oracle/PROD01/apps/tech_st/10.1.3/appsutil/jdk/jre/lib/rt.jar:/AP1/oracle/PROD01/apps/tech_st/10.1.3/appsutil/jdk/jre/lib/sunrsasign.jar:/AP1/oracle/PROD01/apps/tech_st/10.1.3/appsutil/jdk/jre/lib/jsse.jar:/AP1/oracle/PROD01/apps/tech_st/10.1.3/appsutil/jdk/jre/lib/jce.jar:/AP1/oracle/PROD01/apps/tech_st/10.1.3/appsutil/jdk/jre/lib/charsets.jar:/AP1/oracle/PROD01/apps/tech_st/10.1.3/appsutil/jdk/jre/classes]
[100112_105234223][][EXCEPTION] [DEBUG] [java.vendor]:[Sun Microsystems Inc.]
[100112_105234223][][EXCEPTION] [DEBUG] [FND_JDBC_BUFFER_MAX]:[2]
[100112_105234223][][EXCEPTION] [DEBUG] [file.separator]:[]
[100112_105234223][][EXCEPTION] [DEBUG] [java.vendor.url.bug]:[http://java.sun.com/cgi-bin/bugreport.cgi]
[100112_105234223][][EXCEPTION] [DEBUG] [sun.io.unicode.encoding]:[UnicodeLittle]
[100112_105234223][][EXCEPTION] [DEBUG] [sun.cpu.endian]:[little]
[100112_105234223][][EXCEPTION] [DEBUG] [APPLOUT]:[out]
[100112_105234223][][EXCEPTION] [DEBUG] [sun.cpu.isalist]:[]
[10/1/12 10:52:35 AM] [UNEXPECTED] [157635:RT1296337] java.lang.reflect.InvocationTargetException
at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method)
at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39)
at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25)
at java.lang.reflect.Method.invoke(Method.java:597)
at oracle.apps.xdo.common.xml.XSLT10gR1.invokeParse(XSLT10gR1.java:517)
at oracle.apps.xdo.common.xml.XSLT10gR1.transform(XSLT10gR1.java:224)
at oracle.apps.xdo.common.xml.XSLTWrapper.transform(XSLTWrapper.java:177)
at oracle.apps.xdo.template.fo.util.FOUtility.generateFO(FOUtility.java:1044)
at oracle.apps.xdo.template.fo.util.FOUtility.generateFO(FOUtility.java:997)
at oracle.apps.xdo.template.fo.util.FOUtility.generateFO(FOUtility.java:212)
at oracle.apps.xdo.template.FOProcessor.createFO(FOProcessor.java:1665)
at oracle.apps.xdo.template.FOProcessor.generate(FOProcessor.java:975)
at oracle.apps.xdo.oa.schema.server.TemplateHelper.runProcessTemplate(TemplateHelper.java:5936)
at oracle.apps.xdo.oa.schema.server.TemplateHelper.processTemplate(TemplateHelper.java:3459)
at oracle.apps.xdo.oa.schema.server.TemplateHelper.processTemplate(TemplateHelper.java:3548)
at oracle.apps.fnd.cp.opp.XMLPublisherProcessor.process(XMLPublisherProcessor.java:285)
at oracle.apps.fnd.cp.opp.OPPRequestThread.run(OPPRequestThread.java:173)
Caused by: oracle.xdo.parser.v2.XMLParseException: Expected ';'.
at oracle.xdo.parser.v2.XMLError.flushErrors1(XMLError.java:337)
at oracle.xdo.parser.v2.NonValidatingParser.parseDocument(NonValidatingParser.java:305)
at oracle.xdo.parser.v2.XMLParser.parse(XMLParser.java:289)
... 17 more
[10/1/12 10:52:35 AM] [157635:RT1296337] Completed post-processing actions for request 1296337.
[GC 8059K->6286K(8692K), 0.0076290 secs]
[Full GC[Unloading class sun.reflect.GeneratedSerializationConstructorAccessor17]
[Unloading class sun.reflect.GeneratedSerializationConstructorAccessor19]
[Unloading class sun.reflect.GeneratedSerializationConstructorAccessor18]
[Unloading class sun.reflect.GeneratedSerializationConstructorAccessor13]
6286K->3865K(8692K), 0.0446370 secs]
Please help great appriciation.
Thanks,
Sidharth.A semi colon character was expected. Error processing resource 'http://orappsus64.tsindia.in:8009/OA_CGI/FNDWRR.exe?temp_id...
<CP_PROJECT>IT/Quintiles/J&J COGNOS</CP_PROJECT>
----------------------------^
n-left:1em;text-indent:-2em"> <GL_MAIN_PERIOD>Jun-12</GL_MAIN_PERIOD>
<TOTAL_REVENUE>4026.14</TOTAL_REVENUE>
<GL_PERIOD>Jun-12</GL_PERIOD>
</G_TOTAL_REVENUE_CAT>
{code}
Your PL/SQL code doesn't produce a valid XML document.
In the XML grammar, "&" is a special character and must be escaped using the character entity "&amp;".
If you were using standard methods to build XML from Oracle (SQL/XML functions for instance), I'm sure you wouldn't have this error.
Please show us the PL/SQL code you're using to produce this XML output and we'll be able to help you further. -
i wrote a java application using jtidy package for converting html files in xml ones.But after this conversion a sentence like "Login or Password is incorrect." became something like this:"Login or Password is ◙(ALT+10)incorrect ",so i can't apply the xpath query "//text()='Login or Password is incorrect.'" because the result is FALSE.
I tried to use this query://text()=concat('Login or Password is',codepoints-to-string(10),'incorrect');this query is exact,but java doesn't know the function CODEPOINTS-TO-STRING()..
Is there anyone who knows how to solve this problem???Java? That looks like XPath to me.
Why do something complicated like codepoints-to-string, which would involve loading and installing and configuring something that supports XPath 2.0, when you could just use a standard XML escape sequence for \n. I think it's or something a lot like that. -
Cannot close an XML file used for parsing
Hi All,
I appears to have difficulty closing (possibly flushing it first) an XML file that was subsequently being parsed without success. The error generated is:
org.jdom.input.JDOMParseException: Error on line 23: The element type "form" must be terminated by the matching end-tag "</form>".
Below is the code snippets of readData() to retrieve (HTML) data from a website, save it to a file, then convert to XML format before returning the new filename:
public String readData() {
try {
URL url = new URL("http://www.abc.com");
URLConnection connection = url.openConnection();
InputStream isInHtml = url.openStream(); // throws an IOException
disInHtml = new DataInputStream(new BufferedInputStream(isInHtml));
System.out.flush();
FileOutputStream fosOutHtml = null;
fosOutHtml = new FileOutputStream("C:\\Temp\\ABC.html");
int oneChar, count=0;
while ((oneChar=disInHtml.read()) != -1)
fosOutHtml.write(oneChar);
isInHtml.close();
disInHtml.close();
fosOutHtml.flush(); // optional
fosOutHtml.close();
try {
File fileInHtml = new File("C:\\Temp\\ABC.html");
FileReader frInHtml = new FileReader(fileInHtml);
BufferedReader brInHtml = new BufferedReader(frInHtml);
String string = "";
while (brInHtml.ready())
string += brInHtml.readLine() + "\n";
fwOutXml = new FileWriter("C:\\Temp\\ABC.xml");
pwOutXml = new PrintWriter(fwOutXml);
light_html2xml html2xml = new light_html2xml();
pwOutXml.print(html2xml.Html2Xml(string));
system.out.flush() // optional
fwOutXml.flush(); // optional
fwOutXml.close();
pwOutXml.flush(); // optional
pwOutXml.close();
return fileInHtml.getAbsolutePath();
// parseData reads the XML file using the name returned by readData()
public void parseData(String XMLFilename)
try
FileReader frInXml = new FileReader(FileName);
BufferedReader brInXml = new BufferedReader(frInXml);
SAXBuilder saxBuilder = new SAXBuilder("org.apache.xerces.parsers.SAXParser"); // JDOMParseException generated.
}These codes would worked when they were in a single method but I have since placed some structure around them using a number methods.
This issue has risen in th past where I have been able to close the XML file prior to reading them again. However, I don't have a solution for it this time round.
I am running JDK 1.6.0_10, Netbeans 6.1, JDOM 1.1 on Windows XP platform.
Any assistance would be appreciated.
Many thanks,
JackHi Alain,
I have added the additional I/O statements in the finally clause as follows but the problem still persisted:
readData()
// reading data (html) from the webpage and save it in html format.
try {
catch { . }
finally {
System.out.flush();
isInHtml.close();
disInHtml.close();
fosOutHtml.flush();
fosOutHtml.getFD().sync();
fosOutHtml.close();
// convert the html webpage format to xml format
try {
catch { . }
finally {
System.out.flush();
fwOutXml.flush();
fwOutXml.close();
pwOutXml.flush();
pwOutXml.close();
Below is a short listing of the new XML file:
<?xml version="1.0" encoding="iso-8859-1" ?>
- <html>
- <head>
<meta http-equiv="Content-Type" content="text/html; charset=UTF-8" />
<meta name="keywords" content="California, cities, towns, villages, list, zipcodes, postal codes, united states, ca" />
<meta name="description" content="Cities, towns and suburbs in California, United States (CA) starting with A" />
<title>Cities and Towns in California starting with A ABC Company</title>
<link rel="stylesheet" href="http://www.abc.com/style.css" type="text/css" media="screen" />
</head>
- <body>
<a name="top" />
- <div id="container">
- <div id="header">
<div id="postmark" />
- <a href="http://www.abc.com/" class="imglink">
<img id="logoimg" src="http://www.abc.com/images/zipcodes.gif" width="192" height="33" alt="Zipcodes America Logo" />
</a>
<hr />
</div>
- <div id="nav">
- <ul>
- <li>
<a href="http://www.abc.com/" title="Home Page">Home</a>
</li>
- <li>
<strong>Search</strong>
(zipcode or suburb)
- <div class="hide">
<form method="post" action="http://www.abc.com/search" /> // line 23
</div>
<input type="text" name="q" class="searchbox" alt="Search query" />
<br />
<input type="submit" value="find!" class="searchbutton" alt="Perform search" />
<div class="hide" />
</li>
What I find it interesting is that it is possible to parse the above XML file with the same parseData() from another class without any problem. As a result, I have come to the following conclusion so far:
( i ) There is some file locking that is prevent saxBuilder from parsing the XML file at the time.
( ii ) The light_html2xml does not appears to have correctly converted over the orginal Html to Xml but some how it has been picked up by the parser in the same class, but not by the same parser from another class.
( iii ) I would like to use another conversion tool such as Tagsoup in place of light_html2xml to determine where the cause of this issue is coming from. As a result, would you or anyone be able to assist me coming up with a few lines of conversion statements using Tagsoup since I am not familiar with using this tool?
( iv ) light_html2xml is good as it strip out all namespace, DTD, Entity Resolver, etc and only return what I need. JTidy does correct conversion but include namespace, DTD, Entity Resolver which makes parsing difficulty.
Many thanks again,
Jack -
Error while loading an XML document using a structured application
Hi,
I try to load an XML document using a structured application defined in the default structapps.fm
My code is shown down, extracted from the FDK API code sample.
Problem, I always have the same message :
"Cannot find the file named e:\xml\AdobeFrameMaker10\file. Make sure that the file exists. "
Where "e:\xml\AdobeFrameMaker10\" is my install directory.
So I assume that frame try to find the structapps.fm file but does not find it.
What else can it be ?
Does anyone knowns how to achieve this simple task using extendScript ?
Thanks for any comments, Pierre
function openXMLFile(myLastFile) {
var filename = myLastFile.openDlg("Choose XML file ...", "*.xml", false);
if (filename != null) {
/* Get default open properties. Return if it can’t be allocated. */
var params = GetOpenDefaultParams();
/* Set properties to open an XML document*/
/*Specify XML as file type to open*/
var i = GetPropIndex(params, Constants.FS_OpenAsType)
params[i].propVal.ival = Constants.FV_TYPE_XML;
/* Specify the XML application to be used when opening the document.*/
i = GetPropIndex(params, Constants.FS_StructuredOpenApplication)
params[i].propVal.sval = "myApp";
i = GetPropIndex(params, Constants.FS_FileIsOldVersion)
params[i].propVal.ival = Constants.FV_DoOK
i = GetPropIndex(params, Constants.FS_FontNotFoundInDoc)
params[i].propVal.ival = Constants.FV_DoOK
i = GetPropIndex(params, Constants.FS_FileIsInUse)
params[i].propVal.ival = Constants.FV_DoCancel
i = GetPropIndex(params, Constants.FS_AlertUserAboutFailure)
params[i].propVal.ival = Constants.FV_DoCancel
/*The structapps.fm file containing the specified application must have
already been read. The default structapps.fm file is read when FrameMaker is
opened so this shouldn't be a problem if the application to be used is
listed in the structapps.fm file.*/
var retParm = new PropVals()
var fileObj = Open(filename, params, retParm);
return fileObj
} else {
return null;Pierre,
Depending on the object "myLastFile", the method openDlg might not even exist (if the myLastFile object is not a File object, for instance). And I do not see any need for the myLastFile anyhow, as you are presenting a dialog to select a file to open. I recommend using the global ChooseFile( ) method instead. This will give you a filename as string in full path notation, or null when no file was selected in the dialog. I am not sure what your ExtendScript documentation states about the return value for ChooseFile, but if that differs from what I am telling you here, the documentation is wrong. So, if you replace the first lines of your code with the following it should work:
function openXMLFile ( ) {
var filename = ChooseFile ( "Choose XML file ...", "", "*.xml", Constants.FV_ChooseSelect );
While writing this, I see that Russ has already given you the same advice. Use the symbolic constant value I indicated to use the ChooseFile dialog to select a single file (it can also be used to select a directory or open a file - but you want to control the opening process yourself). Note that this method allows you to set a start directory for the dialog (second parameter). The ESTK autocompletion also gives you a fifth parameter "helplink" which is undocumented and can safely be ignored.
Good luck
Jang -
Error while trying to update the XML template using XML Publisher Administrator
Hello Folks,
We are on R12.1.3
I changed a condition in a report and trying to upload the new XML template using XML Publisher Administrator.
when i click the Apply button, it is throwing an error 'Bad Request'
Navigation : XML Publisher Administrator > Data Definitions > query the report
Click on the name of the report > click 'Update file' besides Data Template > Choose file > Click Apply
I am getting the below error
Bad Request
Your browser sent a request that this server could not understand.
Now, i could not upload a new XML template.
Am I doing anything wrong.
regards,
Krisuser10163762 wrote:
Thank you Eugen and Hussein.
The problem is not with the template.
It seems to be a problem in that particular instance.
Uploaded it in a different instance.
However once i run the program, i cannot view the output as the browser window flashes and disappears.
My colleague says , it is to do with the trusted site to download something from the browser.
Can you please guide me on how to fix this ?
http://bit.ly/1k8e2vi
Thanks,
Hussein -
Generate XML output using DBMS_XMLGEN.getxmltype and not from rdf
Hi,
I have a requirement to display output from a particular table in XL format. Out of all the known possible options, I am planning to use the XML publisher to generate XL output.
For the data source, instead of using the conventional way of creating XML data using rdf,I am planning to use DBMS_XMLGEN.getxmltype pl/sql procedure to generate the XML output. And from the output, call the template to generate the required Excel output.
Now, I am using the following code to generate XML output but am not sure how to proceed from here. I need to first print the XML data in the FND Output file after which I was planning to call the 'XML Report Publisher' (XDOREPPB) program and use the current request id to get the excel output but I am not able to find the way to print the XML data in the output file as:
fnd_file.put_line (fnd_file.output, l_xml_type); - is throwing an error as l_xml_type is an XML data output.
PROCEDURE xml_main (
errbuf OUT VARCHAR2
,retcode OUT VARCHAR2
,p_project_from IN VARCHAR2
,p_project_to IN VARCHAR2
AS
l_xml_type XMLTYPE;
BEGIN
SELECT DBMS_XMLGEN.getxmltype
('SELECT fnd_global.conc_request_id
,TO_CHAR (segment1)
,to_char(start_date,''MM/DD/RRRR'')
,to_char(xxmcc_project_details_pkg.current_profit_projection
(project_id),''999,999,990.90'')
,to_char(xxmcc_project_details_pkg.cost_to_date (project_id),''999,999,990.90'')
,''1''
FROM pa_projects_all
WHERE segment1 BETWEEN NVL (p_project_from, segment1)
AND NVL (p_project_to, segment1)')
INTO l_xml_type
FROM DUAL;
fnd_file.put_line (fnd_file.output, l_xml_type);
END xml_main;
Can anyone point me as to how to publish XML output using a PL/SQL procedure (DBMS_XMLGEN.getxmltype)
Thanks.Pl see if the example included in this presentation helps http://www.oracle.com/technology/products/applications/Events/OOW-2006/EBS/S281401_Sridhar_Bogelli.pdf
Also, you do not need to explicitly call XDOREPPB in later versions of XML Publisher. If you set up everything correctly (as described in the presentation above and the link below) the Output Post Processor is called automatically after the XML file is generated successfully.
Another excellent tutorial is at http://www.oracle.com/technology/obe/fusion_middleware/fusion/bi/xmlp_ebiz/index.html
HTH
Srini -
XML page cannot be displayed cannot view XML input using XSL style sheet Please correct the error and then click the REfresh
Is the error message displayed in Firefox or in IE, or in a customized window that doesn't identify the browser?
''If it displays in Firefox:''
It's possible that the Troubleshooter doesn't work correctly unless IE is your default browser. You could test that possibility by having IE make itself the default and testing the Troubleshooter again.
''If it displays in IE or embedded in another Microsoft application:''
In a web search I found these suggestions:
(1) Reset your Internet Explorer settings, according to http://answers.microsoft.com/en-us/ie/forum/ie8-windows_7/cannot-view-xml-using-xsl-style-sheet/ccfe80c6-c0db-4594-a7e3-475f9eac0e85
(2) Try the System File Checker, according to http://ask-leo.com/why_do_i_get_the_xml_page_cannot_be_displayed_after_running_a_microsoft_troubleshooter.html
Any luck? -
How to read the attribute of the xml file using jaxb
Thanks,
Buddy as i have a issue i have to read the xml file using jaxb and xml file contains this data and i have read the attribute like name , desc and action for a particular menu name pls tell the code how to do this it will be a great favour to me
thanx in advance
Rasool
<contextmenu>
<menu name='Lead' >
<menuitem name='newlead' desc='New Lead' action='/leads.do?dispatch=insert' />
<menuitem name='editlead' desc='Edit Lead' action='' />
<menuitem name='leadinfo' desc='Lead Information' action='' />
</menu>
<menu name='Cases' >
<menuitem name='' desc='' action='' />
<menuitem name='' desc='' action='' />
<menuitem name='' desc='' action='' />
</menu>
<menu name='Contact' >
<menuitem name='' desc='' action='' />
<menuitem name='' desc='' action='' />
<menuitem name='' desc='' action='' />
</menu>
</contextmenu>What my program do is to get the encoding of XML files and convert them to UTF-8 encoding files, while I need this "encoding" information of the original XML document thus I can convert...
After reading specifications and JDOM docs, the truth turns to be disappointed, no function is provided to get this information in JDOM level 2(the current released one), while it's promissed that this function will be provided in JDOM level API....
Thanx all for your help and attention!!! -
How to read the data from Excel file and Store in XML file using java
Hi All,
I got a problem with Excel file.
My problem is how to read the data from Excel file and Store in XML file using java excel api.
For getting the data from Excel file what are all the steps i need to follow to get the correct result.
Any body can send me the code (with java code ,Excel sheet) to this mail id : [email protected]
Thanks & Regards,
Sreenu,
[email protected],
india,If you want someone to do your work, please have the courtesy to provide payment.
http://www.rentacoder.com -
Problem inserting value in CLOB column from an XML file using XSU
Hi,
When I try to insert CLOB value into Oracle9i database from an XML document using XSU, I get an exception as below.
09:37:32,392 ERROR [STDERR] oracle.xml.sql.OracleXMLSQLException: 'java.sql.SQLException: ORA-03237: Initial Extent of specified size cannot be allocated
ORA-06512: at "SYS.DBMS_LOB", line 395
ORA-06512: at line 1
' encountered during processing ROW element 0. All prior XML row changes were rolled back. in the XML document.
All Element tags in XML doc. is mapped to columns in the database. One of the table columns is CLOB. That is the one that gives the above exception. Here is the xml...
ID - is autogenerated value.
<?xml version="1.0" ?>
<ROWSET>
<ROW num="1">
<ID></ID>
<SEQ>
GCATAGTTGTTATGAAGAAATGGAAGAAAAATGCACTCAAAGTTGGGCTGTCAGGCTGTCTGGGGCTGAATTCTGGTGTGACAGTGTGATGAAGCCATCTTTGAGCCTAAATTTGATAATGAGCCAGTCATGATCTGGTTGTGATTACTATAACAAGATTAAATCTGAATAAGAGAGCCACAACTTCTTTAAAGACAGATTGTCAAGTCATTACATGGAAGAGGGAGATTGCTCCTTTGTAAATCAGGCTGTCAGGCCAACTGAATGAAGGACGTCATTGTACAGTAACCTGATGAAGATCAGATCAACCGCTCACCTCGCCG
</SEQ>
</ROW>
</ROWSET>
Can anyone identify what's the problem.. and suggest a solution for this..?
Thanks in advance..
VijiWould you please specify the XDK verison and database version?
-
Getting error while running the XML file using XML Publisher Desktop
Hi all,
We have successfully loaded the XML file using XML Publisher Desktop. But when we preview the same using PDF format we are getting the following error.
Font Dir: C:\Program Files\Oracle\XML Publisher Desktop\Template Builder for Word\fonts
Run XDO Start
RTFProcessor setLocale: en-us
FOProcessor setData: C:\Documents and Settings\smanmadh\Desktop\ProductCompensationDT.xml
FOProcessor setLocale: en-us
java.lang.NullPointerException
at oracle.apps.xdo.template.fo.area.PageNumber.formatString(PageNumber.java:104)
at oracle.apps.xdo.template.fo.IDManager.registerId(IDManager.java:44)
at oracle.apps.xdo.template.fo.area.AreaTree.registerLastPageJoinSeq(AreaTree.java:1106)
at oracle.apps.xdo.template.fo.area.AreaTree.incrementJoinSequenceIndex(AreaTree.java:219)
at oracle.apps.xdo.template.fo.area.AreaTree.registerLastPageDocument(AreaTree.java:1089)
at oracle.apps.xdo.template.fo.area.AreaTree.forceOutput(AreaTree.java:471)
at oracle.apps.xdo.template.fo.elements.FORoot.end(FORoot.java:58)
at oracle.apps.xdo.template.fo.FOHandler.endElement(FOHandler.java:386)
at oracle.xml.parser.v2.XMLContentHandler.endElement(XMLContentHandler.java:196)
at oracle.xml.parser.v2.NonValidatingParser.parseElement(NonValidatingParser.java:1212)
at oracle.xml.parser.v2.NonValidatingParser.parseRootElement(NonValidatingParser.java:301)
at oracle.xml.parser.v2.NonValidatingParser.parseDocument(NonValidatingParser.java:268)
at oracle.xml.parser.v2.XMLParser.parse(XMLParser.java:149)
at oracle.apps.xdo.template.fo.FOProcessingEngine.process(FOProcessingEngine.java:279)
at oracle.apps.xdo.template.FOProcessor.generate(FOProcessor.java:1022)
at RTF2PDF.runRTFto(RTF2PDF.java:626)
at RTF2PDF.runXDO(RTF2PDF.java:460)
at RTF2PDF.main(RTF2PDF.java:251)
Thanks in Advance.
Sudeep.This is BI related. You will get a quicker answer from the BI Publisher forum
BI Publisher -
Error while printing generated XML doc using DBMS_OUTPUT
while generating XML document using XDK for PL/SQL i am getting " ORU-10027: buffer overflow, limit of 1000000 bytes " error even though i had set DBMS_OUTPUT to 1000000.
Is there any way to getrid of this problem .
i am using this code ..
CREATE OR REPLACE procedure SQLToXML1 is
queryCtx DBMS_XMLquery.ctxType;
result CLOB;
begin
DBMS_OUTPUT.ENABLE (1000000);
queryCtx := DBMS_XMLQuery.newContext ('select * from depolib_library' )
result := DBMS_XMLQuery.getXML(queryCtx);
printClobOut(result);
DBMS_XMLQuery.closeContext(queryCtx);
exception
when others then
dbms_output.put_line(sqlerrm);
end;
urgent help is needed
Thanks
nullNo, It is a PO Print only. Only for changes to PO that do not affect the value of the PO,this error occurs. When i select the entry for the PO and click on Output message, the output message fails. On clicking Display Message, it shows the message - No schedules exist for the Scheduling Agreement XXXXXX(the PO number".
So,it is not for Scheduling Agreements but for PO only. I know it is weird to see such an error on the PO output message in ME9F.
Pls help. -
Error while running the XML file using XML Publisher Desktop
Hi All,
We have successfully loaded the XML file using XML Publisher Desktop.But when we try to preview it using the PDF format we are getting the following error.
Font Dir: C:\Program Files\Oracle\XML Publisher Desktop\Template Builder for Word\fonts
Run XDO Start
RTFProcessor setLocale: en-us
FOProcessor setData: C:\Documents and Settings\smanmadh\Desktop\ProductCompensationDT.xml
FOProcessor setLocale: en-us
java.lang.NullPointerException
at oracle.apps.xdo.template.fo.area.PageNumber.formatString(PageNumber.java:104)
at oracle.apps.xdo.template.fo.IDManager.registerId(IDManager.java:44)
at oracle.apps.xdo.template.fo.area.AreaTree.registerLastPageJoinSeq(AreaTree.java:1106)
at oracle.apps.xdo.template.fo.area.AreaTree.incrementJoinSequenceIndex(AreaTree.java:219)
at oracle.apps.xdo.template.fo.area.AreaTree.registerLastPageDocument(AreaTree.java:1089)
at oracle.apps.xdo.template.fo.area.AreaTree.forceOutput(AreaTree.java:471)
at oracle.apps.xdo.template.fo.elements.FORoot.end(FORoot.java:58)
at oracle.apps.xdo.template.fo.FOHandler.endElement(FOHandler.java:386)
at oracle.xml.parser.v2.XMLContentHandler.endElement(XMLContentHandler.java:196)
at oracle.xml.parser.v2.NonValidatingParser.parseElement(NonValidatingParser.java:1212)
at oracle.xml.parser.v2.NonValidatingParser.parseRootElement(NonValidatingParser.java:301)
at oracle.xml.parser.v2.NonValidatingParser.parseDocument(NonValidatingParser.java:268)
at oracle.xml.parser.v2.XMLParser.parse(XMLParser.java:149)
at oracle.apps.xdo.template.fo.FOProcessingEngine.process(FOProcessingEngine.java:279)
at oracle.apps.xdo.template.FOProcessor.generate(FOProcessor.java:1022)
at RTF2PDF.runRTFto(RTF2PDF.java:626)
at RTF2PDF.runXDO(RTF2PDF.java:460)
at RTF2PDF.main(RTF2PDF.java:251)
Any pointers will be of great help.
Thanks in Advance
Sudeep.2¢
I had a similar error which when I searched, came up with this thread.
My issue was resolved after I discovered that my RTF template was not really RTF. It was sill in MS Word DOC format. This was discovered by reviewing two templates in NOTEPAD. The MS-DOC files have a lot of "special" characters in them. My RTF was not really RTF.
After doing a SAVE AS - RTF format, then the preview worked as expected.
Just Sharing...
--Tim -
Writing an XML file using a Servlet
Hello, I'm trying to code a servlet that receives a POST from a HTTP and output its data to a XML file, the problem is that I get the following error:
The XML page cannot be displayed
Cannot view XML input using style sheet. Please correct the error and then click the Refresh button, or try again later.
XML document must have a top level element. Error processing resource 'http://localhost:8080/XMLSender/xmlsend'.
I don't know what happens, because I'm NOT trying to show the content, just to save it, I post my code here so anyone can help me, please. Thanks in advance.
import javax.servlet.*;
import javax.servlet.http.*;
import java.io.*;
public class xmlsender extends HttpServlet
public void service(HttpServletRequest req, HttpServletResponse res)
throws ServletException, IOException
ServletOutputStream salida = res.getOutputStream();
res.setContentType("text/xml");
String cadenanumero = req.getParameter("numero");
String cadenaoperadora = req.getParameter("operadora");
String cadenabody = req.getParameter("mensaje");
String cadenashortcode = req.getParameter("shortcode");
File f1 = new File("salida.xml");
FileWriter writer = new FileWriter(f1);
writer.write("<?xml version=\"1.0\" encoding=\"utf-8\"?>");
writer.write("<root>");
writer.write("<tlf>" + cadenanumero + "</tlf>");
writer.write("<op>" + cadenaoperadora + "</op>");
writer.write("<sc>" + cadenashortcode + "</sc>");
writer.write("<body>" + cadenabody + "</body>");
writer.write("</root>");
writer.close();
}Yes, in fact what I want is the file to be in the server, now, I modificated my code to the following:
import javax.servlet.*;
import javax.servlet.http.*;
import java.io.*;
public class xmlsender extends HttpServlet
public void service(HttpServletRequest req, HttpServletResponse res)
throws ServletException, IOException
ServletOutputStream salida = res.getOutputStream();
res.setContentType("text/HTML");
String cadenanumero = req.getParameter("numero");
String cadenaoperadora = req.getParameter("operadora");
String cadenabody = req.getParameter("mensaje");
String cadenashortcode = req.getParameter("shortcode");
File f1 = new File ("salida.xml");
FileWriter writer = new FileWriter(f1);
/*salida.println("<?xml version=\"1.0\" encoding=\"utf-8\"?>");
salida.println("<root>");
salida.println("<tlf>" + cadenanumero + "</tlf>");
salida.println("<op>" + cadenaoperadora + "</op>");
salida.println("<sc>" + cadenashortcode + "</sc>");
salida.println("<body>" + cadenabody + "</body>");
salida.println("</root>"); */
salida.println("Finalizado");
f1.createNewFile();
writer.write("<?xml version=\"1.0\" encoding=\"utf-8\"?>");
writer.write("<root>");
writer.write("<tlf>" + cadenanumero + "</tlf>");
writer.write("<op>" + cadenaoperadora + "</op>");
writer.write("<sc>" + cadenashortcode + "</sc>");
writer.write("<body>" + cadenabody + "</body>");
writer.write("</root>");
writer.close();
It still do not create my file "salida.xml", still don't know why. Any help is welcome.
Maybe you are looking for
-
I changed my screensaver to the itunes album art slideshow the day I got my macbook pro. I have been unable to change it since then. Going through system preferences, then clicking "desktop and screensaver" will bring me to the window where I should
-
Ctrl+tab is not working in editing mode
I have JcheckBox and JTable in my JPanel. When user clicks or presses F2 to edit any cell value of the JTable a comboBox will appear with possible values. (This comboBox is coming from table CellEditor). When user presses ctrl+tab from the table focu
-
How do I remove my iCloud from other devices
My phone is in sync with another phone through my iCloud. I no longer have the other phone.
-
Failure to consistently connect to network.
I have several MacBooks, iPhones, Apple TV's and a couple of other devices all connecting to my home network. I just purchased two new Airport Extremes and an Airport Express. They are all hardwired to a time capsule that is connected to my cable m
-
Print Center / Printer Setup Utility missing
My refurb iMac had its entire logic board replaced several weeks ago. Since then I have not been able to use my Epson Stylus Photo R280 printer. Turns out that somehow my utilities called Print Center and also Printer Setup Utility have disappeared f