Removing unwanted from string

I am trying to remove unwanted from a string. For example:
String is "boy the movie part 2 (2009)". from this string i wanted to remove "(2009)" only, so my string can be looked like as "boy the movie part 2".
Please provide me logic to do this.
Thanks,
Amol

gimbal2 wrote:
Hey if that's all you need:
[snip]
Just substring minus the last six characters and to not have to make any assumptions about whitespace being present in the result, a trim() is added for the fun of it.
This is absolutely not fail proof, but it does what you ask.@OP: Most likely this is not what you really want. However, as gimbal2 points out, it does what you ask. The lesson is, you need to be clear and precise in expressing your requirements. To drive the point home, here is some more code that does what you asked for, but probably not what you really want it do do.
if (str.equals("boy the movie part 2 (2009)") {
  str = "boy the movie part 2";
}

Similar Messages

  • Remove "&" charachter from string

    Hi,
    Please inform me how can i remove the & from string.
    i try this but not working.
    SELECT REGEXP_REPLACE(’raise the level of &performance, creativity',’&','') COL1 FROM DUAL;
    Also i want to remove any special character from statement.
    many thanks

    Ayham wrote:
    i try this but not working.
    SELECT REGEXP_REPLACE(’raise the level of &performance, creativity',’&','') COL1 FROM DUAL;Are you getting any error?
    SQL> set define off
    SQL> SELECT REPLACE('raise the level of &performance, creativity','&') COL1
      2  FROM DUAL;
    COL1
    raise the level of performance, creativity>
    Also i want to remove any special character from statement.
    Search the forum..
    Sample:Re: How to find Special Characters in a single query
    Edited by: jeneesh on Sep 17, 2012 12:26 PM

  • Best way to remove apostrophe from string when loadiing

    Hi using an insert statement to load data some apostrophe's in string .
    We need to ensure all aposrophe's removed from such strings on loading/.
    What is best way to achive ethis.
    Uisng 11.2.0.3
    Thanks

    Use replace fucntion
    Please post ur DDL and DML for the table
    For examples you can see this
    how do i replace  single quotes in a string with say  ''  or null
    select replace('ab''''''''cd','''',' ') from dual;
    CREATE TABLE my_table
         istrng  varchar2(33)
    insert into my_table
    select replace('ab''''''''cd','''',' ') from dual;Please mark your questions as answered
          user5716448     
    Handle:      user5716448 
    Status Level:      Newbie
    Registered:      Mar 16, 2010
    Total Posts:      343
    Total Questions:      131 (80 unresolved)Edited by: Rahul India on Jan 29, 2013 6:04 PM

  • Remove .00 from string while conversion

    How do i remove .00, .01 from the string while converting that string to int
    i tried to do this
    Select REPLACE(CONVERT(varchar(15), [Cases], 1), '.00', '') from table
    UPDATE table
    SET [CASES_d] = CAST(REPLACE(CONVERT(varchar(15), [Cases], 1), '.00', '') AS INT)
    I get the error
    Conversion failed when converting the varchar value '1.10' to data type int.
    can somebody help
    Thanks

    Sorry, in that code I missed intermediate conversion into decimal(10,2). I forgot we can not convert directly.
    So, try:
    update table set cases_id = case when cases like '%[^0-9.]%' then 0 else cast(cast(Cases as decimal(10,2)) as int) end
    where cases not like '%[^0-9.]%' -- exclude updating bad rows
    For every expert, there is an equal and opposite expert. - Becker's Law
    My blog
    My TechNet articles

  • Removing comma (,) from string

    Hello Friends,
    I have a string something of this nature
    Sting : ',3456,45454,,45454,'
    Need to have just comma seperated value : '3456,45454,45454'
    Tried with replace but getting - '34564545445454'
    select replace ( ltrim(RTRIM(replace(',3456,45454,,45454,', ',,', ','),',')),',', '') from dual;
    Appreciate your help .
    Thanks/Kumar

    Hi, Kumar,
    kumar73 wrote:
    Hello Friends,
    I have a string something of this nature
    Sting : ',3456,45454,,45454,'
    Need to have just comma seperated value : '3456,45454,45454'
    Tried with replace but getting - '34564545445454'
    select replace ( ltrim(RTRIM(replace(',3456,45454,,45454,', ',,', ','),',')),',', '') from dual;Do you want to remove ','s at the beginning of the string, but leave them in the other places?
    If so:
    LTRIM (string, ',')LTRIM removes the given character(s) from the <b>L</b>eft side (that is, the beginning) of string. That's all you want here. (Was your string generated by SYS_CONNECT_BY_PATH? This is a very common problem.)
    RTRIM removes the given character(s) from the <b>R</b>ight side (that is, the end) of string. I don't think you want that; you certainly don;'t need it in the example you gave.
    REPLACE removes the given characters anywhere in the string. You definitely don't want that. If you did, there would be no point in also using LTRIM or RTRIM.

  • How to remove unwanted from desktop

    My macbook air was once used some pen drive and some unwanted appeared on my desktop i want to remove that . How?

    Please help me whenever you find an answer for my problem

  • Removing characters from string after a certain point

    Im very new to java programming, so if this is a realy stupid question, please forgive me
    I want to remove all the characters in my string that are after a certain character, such as a backslash. eg: if i have string called "myString" and it contains this:
    109072\We Are The Champions\GEMINI
    205305\We Are The Champions\Queen
    4416\We Are The Champions\A Knight's Tale
    a00022723\We Are The Champions\GREEN DAYi would like to remove all the characters after the first slash (109072*\*We...) leaving the string as "109072"
    the main problem is that the number of characters before and after is not the always the same, and there is often letters in the string i want, so it cant be separated by removing all letters and leaving the numbers
    Is there any way that this can be done?
    Thanks in advance for all help.

    You must learn to use the Javadoc for the standard classes. You can download it or reference it on line. For example [http://java.sun.com/javase/6/docs/api/java/lang/String.html|http://java.sun.com/javase/6/docs/api/java/lang/String.html].

  • How to Remove Text From Strings ?

    Hi,
    The question I have is, in the String that I have Pasted below, how can I remove the first line (>gi|23821530|dbj||SEG_D10989S Bos taurus gene for endothelin receptor) and then use the remainder of the text to Post to a web server?
    I have tried doing this with a Regex (Pattern P = Pattern.compile("(^>.*)");), I'm able to capture the first line of text, but am not sure how to remove it and then use the rest of the text to Post to the web server.
    Any Help with this would be much appreciated
    gi|23821530|dbj||SEG_D10989S Bos taurus gene for endothelin receptorGGGATCCCGAGCAAACTGCGGAGGCCACACTGTCAGGCATTCCCTCGGCGTTTCGTCAGAGCCAGACCCT
    CCCGCTGCTGAAGGGAGGCGCGCTCTGCTCCCGGGCTGCCGGGAACCCAGCCGCGCGCCGGGGAAGGAGG
    TCCCTGCCTGGTGCGTCCGGACCAAGAGGTAACCGTTCTGCTTGGTGTTTAATTCAAATCTGTGATTGAA
    CCTTATCCTGGGGCTTCAGTTTGGATTACTTCTTAGGTTTGTTTTTGTTTGTTTGTTTGTTTTTTAACCT
    GTAGCTACAGCAGATTAAAATGGGATTGGAGTGAAGGAGAGGGCTTGAGTGTCTGAAGTCACTCGAAGGG
    GATAGAAACTTCCGAGTTAATCCAGATAGAGACTCTTCCAAATAGACCAAGTGGAGATGTCCGGGAGATT
    TTCCGAGTCAGCCGGCTCAGTCCTGGGGTGTGTGTATGGGGGGTGGGGGCGGTGCCGAAGAGCGGAAGGA
    AGGGGTCTGAAAGTCCAGACATGCGGCATCCGGGGTTGCTGTGGAGTCGAAAGCAGAGACTGGCGATGCC
    CTTGATCTCTAACCTGCCTTGATTTGCCCCGTCCCCGCGCGCCCTTGGCCAGAACGAATACTGCTCCCTC
    TGCGCACACCAGGAGCTCAAAGCTTTGCTTTGGACACCCGTCCTCTCCTCCCCGTCACACCCCTTCCAGG

    String foo = "gi|23821530|dbj||SEG_D10989S Bos taurus
    gene for endothelin receptor";
    String totalString = "gi|23821530|dbj||SEG_D10989S Bos
    taurus gene for endothelin receptor
    GGGATCCCGAGCAAACTGCGGAGGCCACACTGTCAGGCATTCCCTCGGCGTTTCG
    CAGAGCCAGACCCT
    CCCGCTGCTGAAGGGAGGCGCGCTCTGCTCCCGGGCTGCCGGGAACCCAGCCGCG
    GCCGGGGAAGGAGG
    TCCCTGCCTGGTGCGTCCGGACCAAGAGGTAACCGTTCTGCTTGGTGTTTAATTC
    AATCTGTGATTGAA
    CCTTATCCTGGGGCTTCAGTTTGGATTACTTCTTAGGTTTGTTTTTGTTTGTTTG
    TTGTTTTTTAACCT
    GTAGCTACAGCAGATTAAAATGGGATTGGAGTGAAGGAGAGGGCTTGAGTGTCTG
    AGTCACTCGAAGGG
    GATAGAAACTTCCGAGTTAATCCAGATAGAGACTCTTCCAAATAGACCAAGTGGA
    ATGTCCGGGAGATT
    TTCCGAGTCAGCCGGCTCAGTCCTGGGGTGTGTGTATGGGGGGTGGGGGCGGTGC
    GAAGAGCGGAAGGA
    AGGGGTCTGAAAGTCCAGACATGCGGCATCCGGGGTTGCTGTGGAGTCGAAAGCA
    AGACTGGCGATGCC
    CTTGATCTCTAACCTGCCTTGATTTGCCCCGTCCCCGCGCGCCCTTGGCCAGAAC
    AATACTGCTCCCTC
    TGCGCACACCAGGAGCTCAAAGCTTTGCTTTGGACACCCGTCCTCTCCTCCCCGT
    ACACCCCTTCCAGG";
    int position = -1;
    int lenght = -1;
    position = totalString.indexOf(foo) + foo.length();
    String processedString =
    totalString.substring(position);
    Thanks for the post,
    Did the job perfectly!
    cheers again

  • Remove tabs from string

    hey
    I've a string like "1 2 3 4" and i want to filter the tabs, the requested result is : "1234"
    I was wondering if there any easy way (some String method ?) that i can use
    Thanks

    igalep132 wrote:
    thanks for quick answer
    it's not what i need...
    eventually i need one string like "1234", without empty sringsCute; how many characters does the String "abcd" contain? Four? Nope, there are a kazillion empty strings between each character, you just can't see them ;-)
    kind regards,
    Jos

  • Remove tokens from string and sort string via  XSLT mapping

    Hi,
    I have a requirement wherein I need to sort the records in an XML file with customer num & order number.
    The value of order number is concatenation of order and item like: 3249_110 , 3249_10, 3290_110,3290_10 and so on.
    Expected result:
    3249_10
    3249_110
    3290_10
    3290_110
    The sort on order number is not giving correct result as its not considering it as an number and the output I am getting is:
    3249_110
    3249_10
    3290_110
    3290_10
    code used:
    <xsl:for-each select="DELIVERYHEADER">
                   <xsl:sort select="./EXTCUSTOMERNO"/>
                   <xsl:sort data-type="number" order="ascending" select="/EXTORDERNO"/>
                   <xsl:copy-of select=".">
                   </xsl:copy-of>
    Please suggest.
    Thanks!
    Indu Khurana

    Source:
    <?xml version="1.0" encoding="ISO-8859-1"?>
    <ORIONSHIPMENTS>
         <TRIP>
              <ACTION>I</ACTION>
              <SHIFTNO>1</SHIFTNO>
              <SEQUENCENO>1</SEQUENCENO>
              <DATE>2010-12-20 00:00:00</DATE>
              <STARTDATE>2010-12-20 06:00:00</STARTDATE>
              <ENDDATE>2010-12-20 14:54:00</ENDDATE>
              <TRIPNO>10</TRIPNO>
              <TRIPMNEMONIC/>
              <DRIVERID>DRIVERORT2</DRIVERID>
              <DRIVERNO>DRIVERORT2</DRIVERNO>
              <EXTDRIVERNO>12345</EXTDRIVERNO>
              <TRUCKID>Truck 01</TRUCKID>
              <TRUCKNO>Truck 01</TRUCKNO>
              <EXTTRUCKNO>5002053</EXTTRUCKNO>
              <TRAILERID>Trailer 2</TRAILERID>
              <TRAILERNO>Trailer 2</TRAILERNO>
              <EXTTRAILERNO>ORTEC00002</EXTTRAILERNO>
              <DELIVERYCT>2</DELIVERYCT>
              <LOADCT>1</LOADCT>
              <STARTDEPOTNO>GHENT_N</STARTDEPOTNO>
              <EXTSTARTDEPOTNO>4020</EXTSTARTDEPOTNO>
              <ENDDEPOTNO>GHENT_N</ENDDEPOTNO>
              <EXTENDDEPOTNO>4020</EXTENDDEPOTNO>
              <STARTLOCATIONNO>GHENT_N</STARTLOCATIONNO>
              <EXTSTARTLOCATIONNO>4020</EXTSTARTLOCATIONNO>
              <ENDLOCATIONNO>GHENT_N</ENDLOCATIONNO>
              <EXTENDLOCATIONNO/>
              <ANCILLARYTIME>0</ANCILLARYTIME>
              <LOADINGTIME>0</LOADINGTIME>
              <DISCHARGETIME>245</DISCHARGETIME>
              <DRIVETIME>289</DRIVETIME>
              <DISTANCE>0</DISTANCE>
              <LOADINGSTARTED>0</LOADINGSTARTED>
              <COMMENT/>
              <LOAD>
                   <ACTION>I</ACTION>
                   <LOADID />
                   <LOADIDADD />
                   <SEQUENCENO>0</SEQUENCENO>
                   <LOADINGDEPOTNO>GHENT_N</LOADINGDEPOTNO>
                   <EXTLOADINGDEPOTNO>4020</EXTLOADINGDEPOTNO>
                   <LOADINGPOINT />
                   <AUTHORISATIONCODE />
                   <COMPARTMENTTO>
                        <COMPARTMENTNO>1</COMPARTMENTNO>
                        <PRODUCTNO>401611</PRODUCTNO>
                        <EXTPRODUCTNO>000000000000401611</EXTPRODUCTNO>
                        <VOLUME>65</VOLUME>
                        <UOM>LT</UOM>
                   </COMPARTMENTTO>
              </LOAD>
              <DELIVERYHEADER>
                   <ACTION>I</ACTION>
                   <SEQUENCENO>1</SEQUENCENO>
                   <ORDERNO>3949_20</ORDERNO>
                   <EXTORDERNO>3949_201</EXTORDERNO>
                   <CUSTORDERNO>01.01 Crea</CUSTORDERNO>
                   <CUSTOMERNO>0050000001</CUSTOMERNO>
                   <EXTCUSTOMERNO>0050000001</EXTCUSTOMERNO>
                   <DELIVERYNAME>TEST ORTEC</DELIVERYNAME>
                   <DELIVERYADDRESS1>Rue de Belgique</DELIVERYADDRESS1>
                   <DELIVERYADDRESS2/>
                   <DELIVERYADDRESS3/>
                   <DELIVERYPOSTCODE/>
                   <DELIVERYTOWN/>
                   <DELIVERYCOUNTRY>BE</DELIVERYCOUNTRY>
                   <INVOICENAME/>
                   <INVOICEADDRESS1/>
                   <INVOICEADDRESS2/>
                   <INVOICEADDRESS3/>
                   <INVOICEPOSTCODE/>
                   <INVOICETOWN/>
                   <INVOICECOUNTRY/>
                   <PHONENUMBER1/>
                   <PHONENUMBER2>0</PHONENUMBER2>
                   <TAXCODE />
                   <CUSTOMERCOMMENTS>0013</CUSTOMERCOMMENTS>
                   <DELIVERYCOMMENTS/>
                   <DOCUMENTTYPE>2</DOCUMENTTYPE>
                   <DELIVERYWINDOWSTARTDATE>2010-12-20 00:00:00</DELIVERYWINDOWSTARTDATE>
                   <DELIVERYWINDOWENDDATE>2010-12-20 23:59:00</DELIVERYWINDOWENDDATE>
                   <DELIVERYLINECT>1</DELIVERYLINECT>
                   <DELIVERYAUTHORISATIONREQUIRED/>
                   <CUSTOMERLANGUAGE/>
                   <CONTACTNAME/>
                   <COMPANYREFERENCE/>
                   <CUSTOMERTAXNO/>
                   <FISCALDELIVERY>0</FISCALDELIVERY>
                   <PAYMENTMETHOD>0</PAYMENTMETHOD>
                   <PAYMENTDAYSDUE>999</PAYMENTDAYSDUE>
                   <CURRENCY/>
                   <CALLBEFOREDELIVERY>0</CALLBEFOREDELIVERY>
                   <GEOFENCEDISTANCE>0</GEOFENCEDISTANCE>
                   <GEOFENCEPHONE/>
                   <SITEACCESSGRADE/>
                   <NORMALTAXRATE/>
                   <SPECIALTAXRATE>0</SPECIALTAXRATE>
                   <DISCOUNT>0</DISCOUNT>
                   <SIGNATURECAPTURED/>
                   <DISTANCELOADINGDEPOT>184</DISTANCELOADINGDEPOT>
                   <DRIVETIMELOADINGDEPOT>145</DRIVETIMELOADINGDEPOT>
                   <DISTANCENEXTSTOP>0</DISTANCENEXTSTOP>
                   <DRIVETIMENEXTSTOP>0</DRIVETIMENEXTSTOP>
                   <LOADRELEVANT/>
                   <DELIVERYLINE>
                        <ACTION>I</ACTION>
                        <MOVEMENTNO>3949_20001</MOVEMENTNO>
                        <EXTMOVEMENTNO>3949_20</EXTMOVEMENTNO>
                        <PRODUCTNO>401611</PRODUCTNO>
                        <EXTPRODUCTNO>000000000000401611</EXTPRODUCTNO>
                        <PLANNEDQTY>20</PLANNEDQTY>
                        <UOM>LT</UOM>
                        <PRICEPERUNIT/>
                        <DISCOUNT/>
                        <COMMENTS/>
                        <COMPARTMENTFROM>
                             <COMPARTMENTNO>1</COMPARTMENTNO>
                             <VOLUME>0</VOLUME>
                             <TANKNO>1</TANKNO>
                             <EXTTANKNO>1</EXTTANKNO>
                             <TANKID>259454</TANKID>
                             <TANKLABEL/>
                             <PRODUCTNO>401611</PRODUCTNO>
                             <EXTPRODUCTNO>000000000000401611</EXTPRODUCTNO>
                             <UOM>LT</UOM>
                        </COMPARTMENTFROM>
                   </DELIVERYLINE>
              </DELIVERYHEADER>
              <DELIVERYHEADER>
                   <ACTION>I</ACTION>
                   <SEQUENCENO>2</SEQUENCENO>
                   <ORDERNO>3949_110</ORDERNO>
                   <EXTORDERNO>3949_110</EXTORDERNO>
                   <CUSTORDERNO>01.01 Crea</CUSTORDERNO>
                   <CUSTOMERNO>0050000001</CUSTOMERNO>
                   <EXTCUSTOMERNO>0050000001</EXTCUSTOMERNO>
                   <DELIVERYNAME>TEST ORTEC</DELIVERYNAME>
                   <DELIVERYADDRESS1>Rue de Belgique</DELIVERYADDRESS1>
                   <DELIVERYADDRESS2/>
                   <DELIVERYADDRESS3/>
                   <DELIVERYPOSTCODE/>
                   <DELIVERYTOWN/>
                   <DELIVERYCOUNTRY>BE</DELIVERYCOUNTRY>
                   <INVOICENAME/>
                   <INVOICEADDRESS1/>
                   <INVOICEADDRESS2/>
                   <INVOICEADDRESS3/>
                   <INVOICEPOSTCODE/>
                   <INVOICETOWN/>
                   <INVOICECOUNTRY/>
                   <PHONENUMBER1/>
                   <PHONENUMBER2>0</PHONENUMBER2>
                   <TAXCODE />
                   <CUSTOMERCOMMENTS>0013</CUSTOMERCOMMENTS>
                   <DELIVERYCOMMENTS/>
                   <DOCUMENTTYPE>2</DOCUMENTTYPE>
                   <DELIVERYWINDOWSTARTDATE>2010-12-20 00:00:00</DELIVERYWINDOWSTARTDATE>
                   <DELIVERYWINDOWENDDATE>2010-12-20 23:59:00</DELIVERYWINDOWENDDATE>
                   <DELIVERYLINECT>1</DELIVERYLINECT>
                   <DELIVERYAUTHORISATIONREQUIRED/>
                   <CUSTOMERLANGUAGE/>
                   <CONTACTNAME/>
                   <COMPANYREFERENCE/>
                   <CUSTOMERTAXNO/>
                   <FISCALDELIVERY>0</FISCALDELIVERY>
                   <PAYMENTMETHOD>0</PAYMENTMETHOD>
                   <PAYMENTDAYSDUE>999</PAYMENTDAYSDUE>
                   <CURRENCY/>
                   <CALLBEFOREDELIVERY>0</CALLBEFOREDELIVERY>
                   <GEOFENCEDISTANCE>0</GEOFENCEDISTANCE>
                   <GEOFENCEPHONE/>
                   <SITEACCESSGRADE/>
                   <NORMALTAXRATE/>
                   <SPECIALTAXRATE>0</SPECIALTAXRATE>
                   <DISCOUNT>0</DISCOUNT>
                   <SIGNATURECAPTURED/>
                   <DISTANCELOADINGDEPOT>184</DISTANCELOADINGDEPOT>
                   <DRIVETIMELOADINGDEPOT>145</DRIVETIMELOADINGDEPOT>
                   <DISTANCENEXTSTOP>173</DISTANCENEXTSTOP>
                   <DRIVETIMENEXTSTOP>144</DRIVETIMENEXTSTOP>
                   <LOADRELEVANT/>
                   <DELIVERYLINE>
                        <ACTION>I</ACTION>
                        <MOVEMENTNO>3949_110001</MOVEMENTNO>
                        <EXTMOVEMENTNO>3949_110</EXTMOVEMENTNO>
                        <PRODUCTNO>401611</PRODUCTNO>
                        <EXTPRODUCTNO>000000000000401611</EXTPRODUCTNO>
                        <PLANNEDQTY>45</PLANNEDQTY>
                        <UOM>LT</UOM>
                        <PRICEPERUNIT/>
                        <DISCOUNT/>
                        <COMMENTS/>
                        <COMPARTMENTFROM>
                             <COMPARTMENTNO>1</COMPARTMENTNO>
                             <VOLUME>0</VOLUME>
                             <TANKNO>1</TANKNO>
                             <EXTTANKNO>1</EXTTANKNO>
                             <TANKID>259454</TANKID>
                             <TANKLABEL/>
                             <PRODUCTNO>401611</PRODUCTNO>
                             <EXTPRODUCTNO>000000000000401611</EXTPRODUCTNO>
                             <UOM>LT</UOM>
                        </COMPARTMENTFROM>
                   </DELIVERYLINE>
              </DELIVERYHEADER>
         </TRIP>
    </ORIONSHIPMENTS>

  • How to remove the comma from string

    Hi,
    I Have string like below :
    String some1="123,44.22";
    I want to remove comma from string and final output should be 12244.22.
    public class getOut{
    public static void main(String args[]){
    String some1="123,44.22";
    getChars(int 0,some1.length(),char[] dst,0);
    can somebody in the forum give me idea how to remove comma from the String and
    have a string without comma.
    Thanks
    Jack

    int idx = oldString.indexOf(',');
    if(idx >= 0)   
          newString = oldString.substring(0, idx) + oldString.substring(idx + 1);or for jdk 1.4 and later
    str = str.replaceAll(",", "");

  • Help :how to remove spaces in string

    could any body please help me in removing spaces from string suppose i have written vivek chhabra and i want to remove spaces in this string and want a string vivekchhabra then how this could be done
    anybody help me please
    vivek

    String string = "Hello - This is a test!";
    String result = string.replaceAll(" ", "");
    System.out.println(result);This code results the following output:
    Hello-Thisisatest!

  • I have hidden unwanted books from the purchased area of the iBooks store, but they're are still appearing on the front page of iOS as cloud downloads, is there a way to remove these from iBooks without using the hide iCloud books button?

    I have hidden unwanted books from the purchased area of the iBooks store, but they're are still appearing on the front page of iOS as cloud downloads, is there a way to remove these from iBooks without using the hide iCloud books button?
    Let me explain a little more. I had downloaded a lot of free books in the past as a trial when iBooks was first released and since then I have decided I no longer want them, because of this I hid them from the purchased section of the iBooks store. The 5 books left are ones I decided to keep as seen in the following picture.
    This is how it appears in iBooks on my mac. There are 4 books downloaded and 1 book that I have decided not to download at this time. I would still like to keep this book available in the cloud incase I want to download it again in the future. You’ll notice that hide iCloud books is not selected, if I wanted to hide the book that I have chosen to keep in the cloud, but have not downloaded yet I could.
    This is exactly how I think this feature should work. If you have hidden a book from your purchases it should not show up in the mac Ibooks app. (I am aware you can never actually delete a purchase, just hide them and that hidden purchases can be restored to your account from within the account management section of the iBooks store).
    The iOS app is working differently for me. Here is a picture of the purchased tab on the iBooks store in iOS Ibooks. Again notice that pictures of Lilly is still yet to be downloaded. This is how I expected it to look.
    If we visit the front page of iOS iBooks the view is very different from what I expected. Here we can see the 4 books I wanted to keep on my device and have downloaded. We can also see the 1 book I wanted to keep, but did not want to store locally on the device and left in iCloud (Pictures of Lilly). However we can also see all the books I had hidden from the purchased section of my iTunes account and which I believe should no-longer be visible, Dracula, frankenstein etc…
    I am aware of the hide iCloud books button within the iOS app, but I did not need to use this to hide the books I had removed from the my purchased section of the iBooks store on the mac, why are they still appearing in iOS?
    I’m still not sure if this is a software glitch or not. This article suggests to me that books can be hidden, but I had already completed these steps.
    https://support.apple.com/en-us/HT201322
    A browse of google also suggests people may have been able to hide past purchases from the front page of iBooks on iOS in the past.
    In case there was an issue with syncing I tried logging in and out of my iTunes account via settings in iOS. Force closing the app, disabling automatic downloads and removing my device from iTunes in the cloud. Syncing with iTunes on the mac did not correct the issue either.
    Interestingly I have the same issue on my iPhone 6 running iOS 8.3 as I do on my iPad mini suggesting that this might be an issue either with my account or with iOS iBooks software in general.
    If there is a way to remove the already hidden iBooks in your account from the front page of iBooks on iOS without using the hide iCloud downloads button? Please help community!

    My apologies for the lack of photos, here is my post again with photos.
    I have hidden unwanted books from the purchased area of the iBooks store, but they're are still appearing on the front page of iOS as cloud downloads, is there a way to remove these from iBooks without using the hide iCloud books button?
    Let me explain a little more. I had downloaded a lot of free books in the past as a trial when iBooks was first released and since then I have decided I no longer want them, because of this I hid them from the purchased section of the iBooks store. The 5 books left are ones I decided to keep as seen in the following picture.
    This is how it appears in iBooks on my mac. There are 4 books downloaded and 1 book that I have decided not to download at this time. I would still like to keep this book available in the cloud incase I want to download it again in the future. You’ll notice that hide iCloud books is not selected, if I wanted to hide the book that I have chosen to keep in the cloud, but have not downloaded yet I could.
    This is exactly how I think this feature should work. If you have hidden a book from your purchases it should not show up in the mac Ibooks app. (I am aware you can never actually delete a purchase, just hide them and that hidden purchases can be restored to your account from within the account management section of the iBooks store).
    The iOS app is working differently for me. Here is a picture of the purchased tab on the iBooks store in iOS Ibooks. Again notice that pictures of Lilly is still yet to be downloaded. This is how I expected it to look.
    If we visit the front page of iOS iBooks the view is very different from what I expected. Here we can see the 4 books I wanted to keep on my device and have downloaded. We can also see the 1 book I wanted to keep, but did not want to store locally on the device and left in iCloud (Pictures of Lilly). However we can also see all the books I had hidden from the purchased section of my iTunes account and which I believe should no-longer be visible, Dracula, frankenstein etc…
    I am aware of the hide iCloud books button within the iOS app, but I did not need to use this to hide the books I had removed from the my purchased section of the iBooks store on the mac, why are they still appearing in iOS?
    I’m still not sure if this is a software glitch or not. This article suggests to me that books can be hidden, but I had already completed these steps.
    https://support.apple.com/en-us/HT201322
    A browse of google also suggests people may have been able to hide past purchases from the front page of iBooks on iOS in the past.
    In case there was an issue with syncing I tried logging in and out of my iTunes account via settings in iOS. Force closing the app, disabling automatic downloads and removing my device from iTunes in the cloud. Syncing with iTunes on the mac did not correct the issue either.
    Interestingly I have the same issue on my iPhone 6 running iOS 8.3 as I do on my iPad mini suggesting that this might be an issue either with my account or with iOS iBooks software in general.
    If there is a way to remove the already hidden iBooks in your account from the front page of iBooks on iOS without using the hide iCloud downloads button? Please help community!
    iPhone 6, iOS 8.3, Also an issue on my iPad mini iOS 8

  • HT4915 I share my iTunes accont with my kids. Many of the songs that they purchase, I do not want in my iphone Library, and I don't want them to play when I have my phone on shuffle. How an I remove unwanted songs from my phone library?

    I share my iTunes accont with my kids. Many of the songs that they purchase, I do not want in my iphone Library, and I don't want them to play when I have my phone on shuffle. How an I remove unwanted songs from my phone library withot affecting their devices?

    These are the downsides of a shared library because if you delete the song from your library it will get also automatically  deleted from your kids library. If you want to proceed then please follow this guide: https://support.apple.com/kb/HT4915

  • How can i remove unwanted e-mail address from my list?

    how can i remove unwanted e-mail address from my list?

    Go to settings -> mail contacts and calendars -> tap on the desired account and choose delete at the bottom of the page. This will delete the email accunt from the device.

Maybe you are looking for

  • Need help for connecting internet in solaris 10

    Hello , I am new to Sunsolaris, recently i installed solaris 10 in my HP laptop. In my lap vista is the host and i installed Virtual box 3.0. Inside virtual box i installed solaris. My problem is not able to connect to internet. Iam using a wireless

  • CC Acrobat XI crashing when moving fields in tab order

    Using Mavericks 10.9.2, Acrobat 11.0.06 When editing a form PDF, if I try to move fields in the tab order (I have tab numbers showing) acrobat crashes. I tried the search fix but that does not help. Using the windows version of Acrobat through CC wor

  • [SOLVED] Can I install Gnome 3 alongside KDE?

    Long story short, I hated everything about Gnome 3 when it first came out, but 3.10 (and 3.12) look sleek. I've just installed it in VBox and it seems great, though there are some graphical issues (I'm guessing that's because of the VBox). Currently

  • Export SWF from AE CS6

    I used to be able to export SWF files directly from AE CS3. But am having difficulty performing that same task in CS6. Under FILE/EXPORT there is an option to choose "Adobe Flash Player (SWF)". However, when I output the file it appears to start rend

  • Commit/Rollback in EclipseLink

    Hi, Most of my changes are wrapped in a pair of EntityManagerHelper.beginTransaction(); save(entity);//or delete(), update(), ... EntityManagerHelper.commit(); How do I handle exceptions and rollbacks? In the above example, do I catch all exceptions