XML Processing using ODI
I need to to persist data from xml to Oracle database ? Is it possible using ODI .I dont need to transform the data , I need to actually load it from xml as it is into the RDBMS tables which already exists using ODI , is it possible ? If possible how can I do that ?
Am I correct in assuming that you want to load the XML string into your database and not the values contained within the XML structure?
So if you had:
<parent>
<child>
<value1>1</value1>
<value2>2</value2>
</child>
</parent>
You would want the entire string rather than values 1 and 2 from the <value1> and <value2> nodes?
G
Similar Messages
-
How to implement Filewatcher process using ODI
Hi,
I need to build an ODI package that will check for a specific file in a specific directory after specific time intervals i.e. it will be a filewatcher process.
My operating system in WINDOWS 7.Could you please let me know how to achieve this.
Regards,
RashmikImplement OdiFileWait.
Refer below link for more details.
http://gerardnico.com/doc/odi/webhelp/en/ref_tools/snpsfilewait.html
Bhabani
http://dwteam.in -
Hi,
I'm a novice new to ODI and would like to get answers to few of my questions.
Scenario
1) I have a set of XML and the schema(s) associated with them.
2) Want to process these XML(s) using ODI and storing them in a target DB.
3) Is it possible to process these XML as real time (i.e. XML(s) messages can come one after another) or ODI is used only for off line activity (e.g. to transfer data from source DB to target, when there are no transactions happening in the source system)
Is this possible to achive the above functionality using ODI? if yes what would be the constraints associated with it.
Any document, which talks about it?
Thanks.Am I correct in assuming that you want to load the XML string into your database and not the values contained within the XML structure?
So if you had:
<parent>
<child>
<value1>1</value1>
<value2>2</value2>
</child>
</parent>
You would want the entire string rather than values 1 and 2 from the <value1> and <value2> nodes?
G -
Re-Using XML file from decode barcode + extract xml process
I was hoping someone could put me in the right direction here. I am decodeing the information stored in a 2D Bar code and sending this information to an XML file, then I am trying to combine that xml file with a blank PDF template but the process is failing beacuse there are some additional tag fields the XML data from the Decode->Extract XML process.
The XML file from the decode process gives the structure below..notice therer some extra tags (lines 2- 4)
<?xml version="1.0" encoding="UTF-8"?>
<xdp:xdp xmlns:xdp="http://ns.adobe.com/xdp/" xmlns:xfa="http://www.xfa.org/schema/xfa-data/1.0/">
<xfa:datasets>
<xfa:data>
<form1>
The XML structure that is expected by the PDF template is as follows
<?xml version="1.0" encoding="UTF-8"?>
<form1>
So the xml output of the Decode barcode + Extract XML process has three extra lines of tag. Is there a way I could use a process within liveCycle to clean out those three lines in real-time before sending the xml to be recombined with the PDF template.
ThanksHi,
What you may do is to use the SetValue and its xpath builder functions to "serialize" the xml into string, "substring" to remove the extra tags, and "concat" to add the extra tags and then "deserialize" it again to an xml to be merged with your form.
Greetings,
Yasser -
Problem while transferring XML to oracle using ODI
Hi,
I need to transform a XML file to Oracle using ODI. i created the target oracle table as usual.
I read the thread on "http://forums.oracle.com/forums/thread.jspa?messageID=1909900�" to create an XML model.
Now my problem is while importing the XML model, in the definition tab, i had given the technology as XML, choosen the appropriate logical shema.
In the reverse tab, i have choosen global as context and what should i do in the SELECTIVE REVERSE tab.
I am not getting any KM in the control tab. so what is the KM for XML and how should i get that?
Please anyone who knows help me...
Thanks in advance,
Ram Mohan T.When you do the reverse, you should be able to do a "Standard Reverse". No KM is needed for that.
When you define an interface to move the data, you should use the SQL KMs to access the data in XML. You will need to have these imported in the project where you define the interface. -
Hi all.
I have posted this in the ODI forum as well, but this may be a more proper place to ask for help.
I'm working on a new dwh solution where the main source of data will come from XML-files. The problem is that we are having difficulties with the use of abstract types in the xsd-file. We currently use ODI to read the XML-files and to store the data in our database, but all fields from the XML-files are not visible in the target tables.
The problem can be simplified like this example:
We have a main element, testElement, which can contain one or more publications.
Publication is of type PublicationType, and PublicationType is an abstract that contains title, author and date.
We have four other types which extends PublicationType; BookType, MagazineType, NewspaperType and AdsType. They all contain additional fields.
XSD-file
<?xml version="1.0" encoding="UTF-8"?>
<schema xmlns="http://www.w3.org/2001/XMLSchema"
targetNamespace="urn:testing:kontroll:example:oppgave:v1"
xmlns:tns="urn:testing:kontroll:example:oppgave:v1"
xmlns:xdb="http://xmlns.oracle.com/xdb"
elementFormDefault="qualified">
<element name="testElement" type="tns:TestElementType" xdb:defaultTable="TEST_TAB" />
<complexType name="TestElementType">
<sequence>
<element name="publication" type="tns:PublicationType" minOccurs="1"
maxOccurs="unbounded" />
</sequence>
</complexType>
<complexType name="PublicationType" abstract="true">
<sequence>
<element name="title" type="string"/>
<element name="author" type="string" minOccurs="0"
maxOccurs="unbounded" />
<element name="date" type="string"/>
</sequence>
</complexType>
<complexType name="BookType">
<complexContent>
<extension base="tns:PublicationType">
<sequence>
<element name="ISBN" type="string"/>
<element name="publisher" type="string"/>
</sequence>
</extension>
</complexContent>
</complexType>
<complexType name="MagazineType">
<complexContent>
<extension base="tns:PublicationType">
<sequence>
<element name="editor" type="string"/>
<element name="period" type="string" minOccurs="0"
maxOccurs="1"/>
</sequence>
</extension>
</complexContent>
</complexType>
<complexType name="NewspaperType">
<complexContent>
<extension base="tns:PublicationType">
<sequence>
<element name="daily" type="boolean"/>
<element name="owner" type="string" minOccurs="0"
maxOccurs="1"/>
</sequence>
</extension>
</complexContent>
</complexType>
<complexType name="AdsType">
<complexContent>
<extension base="tns:PublicationType">
<sequence>
<element name="company" type="string"/>
<element name="article" type="string" />
</sequence>
</extension>
</complexContent>
</complexType>
</schema>
XML-file
<?xml version="1.0" encoding="UTF-8"?>
<tns:testElement xmlns:tns="urn:testing:kontroll:example:oppgave:v1" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="urn:testing:kontroll:example:oppgave:v1 ExampleXMLSchema.xsd ">
<tns:publication xsi:type="tns:BookType">
<tns:title>Boken</tns:title>
<tns:author>Arne Svendsen</tns:author>
<tns:date>2001</tns:date>
<tns:ISBN>78979797</tns:ISBN>
<tns:publisher>The Company Ltd</tns:publisher>
</tns:publication>
<tns:publication xsi:type="tns:MagazineType">
<tns:title>Fancy Magazine</tns:title>
<tns:author>Mads Madsen</tns:author>
<tns:date>2011</tns:date>
<tns:editor>Svante Svantesen</tns:editor>
<tns:period>weekly</tns:period>
</tns:publication>
</tns:testElement>
When tables are generated in the database through ODI I'm not getting all the attributes present in the xml-file.
Can anybody tell me if this should work (and, if yes, why it doesn`t)? Or if the XSD/XML looks wrong in some way?
Is this a known limitation in Oracle or ODI etc.?
Any pointers to documentation describing similar problems would also be helpful.
Thanks,
BjørnHi, Bjørn,
When tables are generated in the database through ODI I'm not getting all the attributes present in the xml-file.I don't know ODI, so I'm just curious here : what tables are generated? Is there one table per extented type (+ child tables for repeating elements), or just one Publication table with missing columns?
I've looked at the other thread you mentioned on the ODI forum, and saw that you'd also want to store XML files in an XMLType table.
I tested the schema registration in the database to see how Oracle reacts to the structure, and it looks OK, type extensions are supported.
SQL> begin
2 dbms_xmlschema.registerSchema(
3 schemaURL => 'ExampleXMLSchema.xsd'
4 , schemaDoc => bfilename('TEST_DIR', 'ExampleXMLSchema.xsd')
5 , local => true
6 , genTypes => true
7 , genTables => true
8 , enableHierarchy => dbms_xmlschema.ENABLE_HIERARCHY_NONE
9 );
10 end;
11 /
PL/SQL procedure successfully completed
SQL> insert into test_tab
2 values (xmltype('<?xml version="1.0" encoding="UTF-8"?>
3 <tns:testElement xmlns:tns="urn:testing:kontroll:example:oppgave:v1"
4 xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance"
5 xsi:schemaLocation="urn:testing:kontroll:example:oppgave:v1 ExampleXMLSchema.xsd ">
6 <tns:publication xsi:type="tns:BookType">
7 <tns:title>Boken</tns:title>
8 <tns:author>Arne Svendsen</tns:author>
9 <tns:date>2001</tns:date>
10 <tns:ISBN>78979797</tns:ISBN>
11 <tns:publisher>The Company Ltd</tns:publisher>
12 </tns:publication>
13 <tns:publication xsi:type="tns:MagazineType">
14 <tns:title>Fancy Magazine</tns:title>
15 <tns:author>Mads Madsen</tns:author>
16 <tns:author>Arne Svendsen</tns:author>
17 <tns:date>2011</tns:date>
18 <tns:editor>Svante Svantesen</tns:editor>
19 <tns:period>weekly</tns:period>
20 </tns:publication>
21 </tns:testElement>'))
22 ;
1 row inserted
Querying as relational data :
SQL> select x.*
2 from test_tab t
3 , xmltable(xmlnamespaces(default 'urn:testing:kontroll:example:oppgave:v1'),
4 'for $i in /testElement/publication
5 return element r {
6 $i/child::*
7 , element pubtype {
8 typeswitch($i)
9 case element(publication, BookType) return "Book"
10 case element(publication, MagazineType) return "Magazine"
11 case element(publication, AdsType) return "Ads"
12 case element(publication, NewspaperType) return "Newspaper"
13 default return "Publication"
14 }
15 }'
16 passing t.object_value
17 columns title varchar2(500) path 'title'
18 , authors varchar2(500) path 'string-join(author,",")'
19 , pubdate number(4) path 'date'
20 , isbn number(13) path 'ISBN'
21 , editor varchar2(500) path 'editor'
22 , period varchar2(500) path 'period'
23 , pubtype varchar2(30) path 'pubtype'
24 ) x
25 ;
TITLE AUTHORS PUBDATE ISBN EDITOR PERIOD PUBTYPE
Boken Arne Svendsen 2001 78979797 Book
Fancy Magazine Mads Madsen,Arne Svendsen 2011 Svante Svantesen weekly Magazine -
Hi All,
I am trying with Ajax using xml process and i implmented the same logic but it got failed. can u please me the line what does this menas:
cursor data_cur is
select empno,
‘<![CDATA[‘ ||
ename ||’]]>’
from emp
where deptno =
:F130_DEPTNO
here the main problem is with the ‘<![CDATA[‘ || .. but when i had tried to remove the CDATA it is working fine i mean it fetching the rows but when ihave tried to implement using cdata it got failed..
can any bosy explain me what the purpose of Cdata..
Thanks,
Anoo..Hi Jair,
Any how please find the deatiled javascript code:
AJAX using an XML Process
declare
cursor data_cur is
select empno,
‘<![CDATA[‘ ||
ename ||’]]>’
from emp
where deptno =
:F130_DEPTNO;
v_results varchar2(1000);
begin
owa_util.mime_header('text/xml', FALSE );
htp.p('Cache-Control: no-cache');
htp.p('Pragma: no-cache');
owa_util.http_header_close;
htp.prn('<options>');
for it in data_cur loop
htp.prn('<option value="' || it.empno || '">' || it.ename || '</option>');
end loop;
htp.prn('</options>');
end;
Javascript code
<script language="JavaScript1.1" type="text/javascript">
function getEmpLov(callObj, pSelect) {
var theSelect = html_GetElement(pSelect);
var get = new htmldb_Get(null,
html_GetElement('pFlowId').value,
'APPLICATION_PROCESS=getEmpLOV',0);
get.add('F130_DEPTNO',callObj.value)
gReturn= get.get('XML');
if(gReturn && theSelect) {
var cnt = gReturn.getElementsByTagName("option").length;
theSelect.length = 0; /*clear existing list*/
var newOpt = document.createElement("option");
newOpt.value = ' ';
newOpt.text = '-Select an Employee-';
try {
theSelect.add(newOpt,null); //standards compliant
catch(ex) {
theSelect.add(newOpt); // IE only
for (var x = 0; x < cnt; x++) {
var newOpt = document.createElement("option");
var xmlRec = gReturn.getElementsByTagName("option")[x];
newOpt.value = xmlRec.getAttribute('value');
newOpt.text = xmlRec.firstChild.nodeValue;
try {
theSelect.add(newOpt,null); //standards compliant
catch(ex) {
theSelect.add(newOpt); // IE only
for (var x = 0; x < cnt; x++) {
var newOpt = document.createElement("option");
var xmlRec = gReturn.getElementsByTagName("option")[x];
newOpt.value = xmlRec.getAttribute('value');
newOpt.text = xmlRec.firstChild.nodeValue;
try {
theSelect.add(newOpt,null); //standards compliant
catch(ex) {
theSelect.add(newOpt); // IE only
get = null;
html_GetElement('theJob').innerHTML = '';
Please let me know if want any more information..
Thanks,
Anoo.. -
Need Help on complex XML loading into ODI
Hi,
I have a requirement in which i have to create xml mapping in ODI which should load 30 to 40 million message per day with file size of 30 MB. I have created xml connection in topology manager and have provided xsd path of unix server and it's working but when I try to reverse xml structure into Designer model then it gave me error " java.sql.SQLException: No DTD found and no XML file provided: the XML schema cannot be created". I have used below xml connection detail in topology manager.
JDBC Driver: com.sunopsis.jdbc.driver.xml.SnpsXmlDriver
jdbc:snps:xml?f=/odi_rep/sita_meg_bi/etl_metadata/&stypex.xsd&re=TYPEX&ro=true&case_sens=true
We are using 10.1.3.6 ODI version in this project.I have given below xsd and xml file format. FYI...we recevie multiple message with same strucutre in xml source file.
XSD File:
XML File :
<tns1:MessageTraceEvent xmlns_tns1="http://www.sita.aero/csbu/tools/v1/namespace" timeStamp="2011-07-13T00:01:09Z" priority="3" envelopeMessageID="xs-atl-xs2011-07-13t00:01:09.525:519160" mes
sageType="TYPEX" messageTotalSize="6506" systemID="bgtxjao">
<tns1:SitaIdentifiers>
<tns1:sitaUID>xPreg1D3RF2tGbF9iUPReA</tns1:sitaUID>
<tns1:TransactionID>dzA5Arb0QZyOOq9NqgrQ2Q</tns1:TransactionID>
</tns1:SitaIdentifiers>
<tns1:previousSitaIdentifiers>
<tns1:sitaUID>xPreg1D3RF2tGbF9iUPReA</tns1:sitaUID>
<tns1:TransactionID>zrL7EtGpTVSYeLpb+2W1NQ</tns1:TransactionID>
</tns1:previousSitaIdentifiers>
<tns1:Addresses>
<tns1:Originator>XS-ATL-XS</tns1:Originator>
<tns1:Recipient>AF-QVI-BP</tns1:Recipient>
<tns1:Recipient>AF-QVI-BP</tns1:Recipient>
</tns1:Addresses>
<tns1:RemoteSystem>
<tns1:Source>
<tns1:NodeID>AF-QVI-BP</tns1:NodeID>
<tns1:MiscData>BadgerID: XS-ATL-XS-1310515269-9.1</tns1:MiscData>
<tns1:isCustomer>false</tns1:isCustomer>
</tns1:Source>
</tns1:RemoteSystem>
<tns1:AdditionalData>
<tns1:TypeXData subject="No message"/>
</tns1:AdditionalData>
<tns1:Payload payloadType="MessageData">PHR4bWU6VFhNX0VudmVsb3BlIHhtbG5zOnR4bWU9Imh0dHA6Ly93d3cuaWF0YS5vcmcvdHhtL2VudmVsb3BlIiB4bWxuczp0eG1zPSJodHRwOi8vd3d3LmlhdGEub3JnL3R4bS9zZXNzaW9
uIiB4bWxuczp0eG1tPSJodHRwOi8vd3d3LmlhdGEub3JnL3R4bS9tc2doZWFkZXIiIHhtbG5zOnR4bWM9Imh0dHA6Ly93d3cuaWF0YS5vcmcvdHhtL2NvbW1hbmQiIHhtbG5zOnR4bXg9Imh0dHA6Ly93d3cuaWF0YS5vcmcvdHhtL3hhdGFwIiB4bWxucz
p0eG1mPSJodHRwOi8vd3d3LmlhdGEub3JnL3R4bS9mYXVsdCIgeG1sbnM6dHhtcj0iaHR0cDovL3d3dy5pYXRhLm9yZy90eG0vcmVwb3J0IiB4bWxuczp0eG11PSJodHRwOi8vd3d3LmlhdGEub3JnL3R4bS9hdXRoIiB4bWxuczp0eG1hPSJodHRwOi8vd
3d3LmlhdGEub3JnL3R4bS9hdHRh
pc3Rvcnk+PC93dHI6QklSX0RlbGF5ZWRCYWdSZWNvcmQ+CgkJPC90eG1lOlRYTV9QYXlsb2FkPgoJPC90eG1lOlRYTV9Cb2R5Pgo8L3R4bWU6VFhNX0VudmVsb3BlPgo=</tns1:Payload>
</tns1:MessageTraceEvent>
Edited by: user13544580 on Jul 18, 2011 6:27 AM<?xml version="1.0" encoding="UTF-8"?>
<!-- edited with XMLSpy v2010 rel. 3 sp1 (http://www.altova.com) by SITA (SITA) -->
XSD File :
<xs:schema xmlns:tns1="http://www.sita.aero/csbu/tools/v1/namespace" xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:ns1="http://www.sita.aero/csbu/tools/v1" targetNamespace="http://www.sita.aero/csbu/tools/v1/namespace" elementFormDefault="qualified" attributeFormDefault="unqualified" version="version 1.0">
<xs:element name="MessageTraceEvent">
<xs:annotation>
<xs:documentation>version 1.0</xs:documentation>
</xs:annotation>
<xs:complexType>
<xs:sequence>
<xs:element name="SitaIdentifiers" type="tns1:SitaIdType">
<xs:annotation>
<xs:documentation>Container for Sita Unique ID and Transaction ID</xs:documentation>
</xs:annotation>
</xs:element>
<xs:element name="previousSitaIdentifiers" type="tns1:SitaIdType" minOccurs="0" maxOccurs="unbounded">
<xs:annotation>
<xs:documentation>Container for previous Sita Unique IDs and Transaction IDs</xs:documentation>
</xs:annotation>
</xs:element>
<xs:element name="relatedSitaIdentifiers" type="tns1:SitaIdType" minOccurs="0" maxOccurs="unbounded">
<xs:annotation>
<xs:documentation>Container for related Sita Unique IDs and Transaction IDs which a delivery report is reporting</xs:documentation>
</xs:annotation>
</xs:element>
<xs:element name="Addresses">
<xs:annotation>
<xs:documentation>Container for Sender and Recipient addresses</xs:documentation>
</xs:annotation>
<xs:complexType>
<xs:sequence>
<xs:element name="Originator" type="tns1:AddressType" minOccurs="0"/>
<xs:element name="Recipient" type="tns1:AddressType" minOccurs="0" maxOccurs="unbounded"/>
</xs:sequence>
</xs:complexType>
</xs:element>
<xs:element name="RemoteSystem">
<xs:annotation>
<xs:documentation>Container for Source or Destination system information</xs:documentation>
</xs:annotation>
<xs:complexType>
<xs:choice>
<xs:element name="Source" type="tns1:HostType"/>
<xs:element name="Destination" type="tns1:HostType"/>
</xs:choice>
</xs:complexType>
</xs:element>
<xs:element name="AdditionalData" minOccurs="0">
<xs:annotation>
<xs:documentation>Service or Billing specific information</xs:documentation>
</xs:annotation>
<xs:complexType>
<xs:choice>
<xs:element name="AFTNData" type="tns1:AFTNDataType" minOccurs="0">
<xs:annotation>
<xs:documentation>Addintinal data gathered on NTS </xs:documentation>
</xs:annotation>
</xs:element>
<xs:element name="TypeBData" type="tns1:TypeBDataType" minOccurs="0">
<xs:annotation>
<xs:documentation>Additional data gathered on MegaSwitch, Sitex or Badgers</xs:documentation>
</xs:annotation>
</xs:element>
<xs:element name="TypeXData" type="tns1:TypeXDataType" minOccurs="0">
<xs:annotation>
<xs:documentation>Additional data gathered on Badgers</xs:documentation>
</xs:annotation>
</xs:element>
<xs:element name="SMTPData" type="tns1:SMTPDataType" minOccurs="0">
<xs:annotation>
<xs:documentation>Additional data gathered on SMTP systems</xs:documentation>
</xs:annotation>
</xs:element>
<xs:element name="FAXData" type="tns1:FAXDataType" minOccurs="0">
<xs:annotation>
<xs:documentation>Additional data gathered on Fax systems</xs:documentation>
</xs:annotation>
</xs:element>
<xs:element name="OmhData" type="tns1:OmhDataType" minOccurs="0">
<xs:annotation>
<xs:documentation>Additional data gathered on OmhData systems</xs:documentation>
</xs:annotation>
</xs:element>
</xs:choice>
</xs:complexType>
</xs:element>
<xs:element name="Payload" minOccurs="0" maxOccurs="unbounded">
<xs:annotation>
<xs:documentation>Used to save the full message as received from customer, it can help us avoid re-transforming it back to original message or be used for debugging</xs:documentation>
</xs:annotation>
<xs:complexType>
<xs:simpleContent>
<xs:extension base="xs:base64Binary">
<xs:attribute name="payloadType">
<xs:simpleType>
<xs:restriction base="xs:string">
<xs:enumeration value="MessageData"/>
<xs:enumeration value="EnvelopeData"/>
</xs:restriction>
</xs:simpleType>
</xs:attribute>
</xs:extension>
</xs:simpleContent>
</xs:complexType>
</xs:element>
</xs:sequence>
<xs:attribute name="timeStamp" type="xs:dateTime" use="required"/>
<xs:attribute name="priority" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation>Priority defines precedence in sending the messages through to destination</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="bodyMessageID" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation>The Message ID in the body, as received from or sent to the customer.</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="envelopeMessageID" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation>The Message ID in the envelope, as received from or sent to the customer.</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="isReport" type="xs:boolean" use="optional" default="false">
<xs:annotation>
<xs:documentation>Is it a delivery or acknowledge report? If so, set it true</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="messageType" type="tns1:MessageType" use="required">
<xs:annotation>
<xs:documentation>The type of message, e.g. TYPEB, TYPEX, SMS, etc.</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="previousMessageType" type="tns1:MessageType" use="optional">
<xs:annotation>
<xs:documentation>The logical message type, where this is different from the physical type. For example a TYPEB message sent to SMTP would have a messageType of SMTP, but previousMessageType of TYPEB.</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="messageBodySize" type="xs:string" use="optional"/>
<xs:attribute name="messageHeadSize" type="xs:string" use="optional"/>
<xs:attribute name="messageTotalSize" type="xs:string" use="optional"/>
<xs:attribute name="PDM" type="xs:boolean" use="optional">
<xs:annotation>
<xs:documentation>True if it is a PDM message.</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="messsageArchive" type="xs:boolean" use="optional">
<xs:annotation>
<xs:documentation>True if the message has been flagged for archiving.</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="messageArchiveDays" type="xs:int" use="optional">
<xs:annotation>
<xs:documentation>The number of days to archive, if known.</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="systemID" type="xs:string" use="required">
<xs:annotation>
<xs:documentation>The unique identifier for the system executing the transaction, e.g. BADGERX, JAOMSW, etc.</xs:documentation>
</xs:annotation>
</xs:attribute>
</xs:complexType>
</xs:element>
<xs:simpleType name="MessageType">
<xs:restriction base="xs:string">
<xs:enumeration value="AFTN"/>
<xs:enumeration value="FAX"/>
<xs:enumeration value="SMTP"/>
<xs:enumeration value="TYPEC"/>
<xs:enumeration value="TYPEB"/>
<xs:enumeration value="TYPEX"/>
<xs:enumeration value="SMS"/>
<xs:enumeration value="X400"/>
<xs:enumeration value="SKYFAX"/>
<xs:enumeration value="OTHER"/>
<xs:enumeration value="TELEX"/>
<xs:enumeration value="URI"/>
<xs:enumeration value="EDI"/>
<xs:enumeration value="EDI-X12"/>
<xs:enumeration value="EDI-EDIFACT"/>
<xs:enumeration value="EDI-BINARY"/>
<xs:enumeration value="EDI-XML"/>
<xs:enumeration value="SPEC2000"/>
</xs:restriction>
</xs:simpleType>
<xs:simpleType name="EventType">
<xs:restriction base="xs:string">
<xs:enumeration value="MessageAccepted"/>
<xs:enumeration value="MessageDispatched"/>
<xs:enumeration value="MessageRejected"/>
</xs:restriction>
</xs:simpleType>
<xs:simpleType name="TypeBPriority">
<xs:restriction base="xs:string">
<xs:enumeration value="AF"/>
<xs:enumeration value="NO"/>
<xs:enumeration value="OK"/>
<xs:enumeration value="QA"/>
<xs:enumeration value="QB"/>
<xs:enumeration value="QC"/>
<xs:enumeration value="QD"/>
<xs:enumeration value="QK"/>
<xs:enumeration value="QN"/>
<xs:enumeration value="QP"/>
<xs:enumeration value="QQ"/>
<xs:enumeration value="QU"/>
<xs:enumeration value="QX"/>
</xs:restriction>
</xs:simpleType>
<xs:simpleType name="FaxServiceName">
<xs:restriction base="xs:string">
<xs:enumeration value="IPFax"/>
<xs:enumeration value="BFax"/>
</xs:restriction>
</xs:simpleType>
<xs:simpleType name="MessageStatusType">
<xs:restriction base="xs:string">
<xs:enumeration value="failed"/>
<xs:enumeration value="relayed"/>
<xs:enumeration value="received"/>
<xs:enumeration value="delivered"/>
<xs:enumeration value="rejected"/>
<xs:enumeration value="re-injected"/>
<xs:enumeration value="intercepted"/>
<xs:enumeration value="drained"/>
<xs:enumeration value="op-dropped">
<xs:annotation>
<xs:documentation>message dropped by an operator</xs:documentation>
</xs:annotation>
</xs:enumeration>
<xs:enumeration value="sys-dropped">
<xs:annotation>
<xs:documentation>message dropped by the messaging system</xs:documentation>
</xs:annotation>
</xs:enumeration>
<xs:enumeration value="odmci">
<xs:annotation>
<xs:documentation>out of date message cancellation input</xs:documentation>
</xs:annotation>
</xs:enumeration>
<xs:enumeration value="odmco">
<xs:annotation>
<xs:documentation>out of date message cancellation output</xs:documentation>
</xs:annotation>
</xs:enumeration>
<xs:enumeration value="other"/>
</xs:restriction>
</xs:simpleType>
<xs:complexType name="AFTNDataType">
<xs:attribute name="isDataCollect" type="xs:boolean" use="optional">
<xs:annotation>
<xs:documentation>To determine a Type B traffic chargeable</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="messageIdentifier" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation/>
</xs:annotation>
</xs:attribute>
<xs:attribute name="SMI" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation>Standard message identifier for Type B messages</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="doubleSignature" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation/>
</xs:annotation>
</xs:attribute>
<xs:attribute name="BATAPSN" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation>The BATAPSN number of a message</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="ISN" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation>The ISN number of a message</xs:documentation>
</xs:annotation>
</xs:attribute>
</xs:complexType>
<xs:complexType name="TypeBDataType">
<xs:attribute name="isDataCollect" type="xs:boolean" use="optional">
<xs:annotation>
<xs:documentation>To determine a Type B traffic chargeable</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="messageIdentifier" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation/>
</xs:annotation>
</xs:attribute>
<xs:attribute name="SMI" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation>Standard message identifier for Type B messages</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="doubleSignature" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation/>
</xs:annotation>
</xs:attribute>
<xs:attribute name="eopt" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation>eopt is 10 numeric characters long and the value is always 0000000000, Eric indicated his team does not populate any value in this field. </xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="documentConversion" type="xs:boolean" use="optional"/>
<xs:attribute name="subject" type="xs:string" use="optional"/>
<xs:attribute name="charSet" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation>The character set of a message body</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="BATAPSN" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation>The BATAPSN number of a message</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="ISN" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation>The ISN number of a message</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="cnxType" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation>The connection Type of a message</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="Location" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation>The location of a connection coming from</xs:documentation>
</xs:annotation>
</xs:attribute>
</xs:complexType>
<xs:complexType name="SMTPDataType">
<xs:attribute name="subject" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation/>
</xs:annotation>
</xs:attribute>
<xs:attribute name="doubleSignature" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation/>
</xs:annotation>
</xs:attribute>
<xs:attribute name="rule" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation/>
</xs:annotation>
</xs:attribute>
<xs:attribute name="resend" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation/>
</xs:annotation>
</xs:attribute>
</xs:complexType>
<xs:complexType name="TypeXDataType">
<xs:attribute name="messageIdentifier" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation/>
</xs:annotation>
</xs:attribute>
<xs:attribute name="doubleSignature" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation/>
</xs:annotation>
</xs:attribute>
<xs:attribute name="documentConversion" type="xs:boolean" use="optional"/>
<xs:attribute name="subject" type="xs:string" use="optional"/>
<xs:attribute name="XATAPSN" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation>The XATAPSN number of a message</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="BadgerId" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation>The BadgerId to a Type X message is what ISN to a Type B message</xs:documentation>
</xs:annotation>
</xs:attribute>
</xs:complexType>
<xs:complexType name="FAXDataType">
<xs:attribute name="errorCode" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation>Error code for the request. 0=success.</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="errorString" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation>The error message, if any.</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="serviceName" type="tns1:FaxServiceName" use="optional">
<xs:annotation>
<xs:documentation>Enum value in FaxServiceType</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="channelNumber" type="xs:int" use="optional">
<xs:annotation>
<xs:documentation>The fax channel on the server.</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="receivedSize" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation>The size of the received message, including headers.</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="convertedSize" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation>The size of the message after conversion for fax.</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="totalSentSize" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation>The sum of the bytes sent, including cover pages and retries.</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="totalConnectTime" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation>The sum of time connected to a fax receiver for all attempts.</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="totalDuration" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation>The sum of the off-hook, or network time, for all attempts.</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="nbrFaxPages" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation>The number of pages in the message, including the cover sheet.</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="totalPages" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation>The sum of the pages sent for all attempts.</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="recvCSID" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation>The CSID received from the remote fax system.</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="tries" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation>The number of fax attmpts.</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="subject" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation/>
</xs:annotation>
</xs:attribute>
<xs:attribute name="acknow" type="xs:string" use="optional"/>
<xs:attribute name="cod" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation/>
</xs:annotation>
</xs:attribute>
<xs:attribute name="referenceNumber" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation>The UFAX MSG_ID for the message.</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="distID" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation>The UFAX MSG_RQ_ID for the message.</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="fineResolution" type="xs:boolean" use="optional">
<xs:annotation>
<xs:documentation>True for Fine resolution, false for Coarse resolution.</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="baudRate" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation>The connection speed for the fax.</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="sitaReceiveTime" type="xs:dateTime" use="optional">
<xs:annotation>
<xs:documentation>The time when the message is received into SITA's network.</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="ufaxReceiveTime" type="xs:dateTime" use="optional">
<xs:annotation>
<xs:documentation>The time when UFAX receives the message, when it is delivered to the UFAX inbox.</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="startConversionTime" type="xs:dateTime" use="optional">
<xs:annotation>
<xs:documentation>The time when the Converter starts processing a message. If it takes more than one attempt to convert the message, this will be the time of the first attempt.</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="endConversionTime" type="xs:dateTime" use="optional">
<xs:annotation>
<xs:documentation>The time when the Converter completes the conversion process. If it takes more than one attempt to convert the message, this will be the time of the last attempt.</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="tfaTime" type="xs:dateTime" use="optional">
<xs:annotation>
<xs:documentation>The time of the first call attempt for the message. If UFAX is already calling the fax number for a different message, then this will be the time the message was queued for calling.</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="completionTime" type="xs:dateTime" use="optional">
<xs:annotation>
<xs:documentation>The time when the fax has been completed, either because the fax was delivered or it reached the maximum error threshold.</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="reportTime" type="xs:dateTime" use="optional">
<xs:annotation>
<xs:documentation>The time when the delivery report is sent. Not used if a report isn't sent.</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="doubleSignature" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation>For BFax, the Double Signature for the message if any.</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="userConfigType" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation>Legacy bit-mapped field for BFax.</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="networkAccessPoint" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation>The network access point where the channel was connected.</xs:documentation>
</xs:annotation>
</xs:attribute>
</xs:complexType>
<xs:complexType name="OmhDataType">
<xs:attribute name="msgIdent" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation/>
</xs:annotation>
</xs:attribute>
<xs:attribute name="sysMsgIdent" type="xs:string" use="required">
<xs:annotation>
<xs:documentation/>
</xs:annotation>
</xs:attribute>
<xs:attribute name="inMsgFmt" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation/>
</xs:annotation>
</xs:attribute>
<xs:attribute name="outMsgFmt" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation/>
</xs:annotation>
</xs:attribute>
<xs:attribute name="toDirection" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation/>
</xs:annotation>
</xs:attribute>
<xs:attribute name="fromDirection" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation/>
</xs:annotation>
</xs:attribute>
<xs:attribute name="inMsgSize" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation/>
</xs:annotation>
</xs:attribute>
<xs:attribute name="outMsgSize" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation/>
</xs:annotation>
</xs:attribute>
<xs:attribute name="compCode" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation/>
</xs:annotation>
</xs:attribute>
<xs:attribute name="applicationId" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation/>
</xs:annotation>
</xs:attribute>
</xs:complexType>
<xs:complexType name="AddressType">
<xs:annotation>
<xs:documentation>This is a generic address object</xs:documentation>
</xs:annotation>
<xs:simpleContent>
<xs:extension base="xs:string">
<xs:attribute name="responsible" type="xs:boolean" use="optional" default="false">
<xs:annotation>
<xs:documentation>Used to denote whether the address should be delivered or not, is the node responsible for delivery of this address</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="typeOfAddress" type="tns1:MessageType" use="optional">
<xs:annotation>
<xs:documentation>Type of the address we are given</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="mapped" type="xs:boolean" use="optional" default="false">
<xs:annotation>
<xs:documentation>Used to denote whether the address is mapped or not</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="masqueraded" type="xs:boolean" use="optional" default="false">
<xs:annotation>
<xs:documentation>used to denote if the address is masqueraded, this happens often when messages are pushed through gateways.</xs:documentation>
</xs:annotation>
</xs:attribute>
<xs:attribute name="masqueradedID" type="xs:string" use="optional">
<xs:annotation>
<xs:documentation>If the address is masqueraded than this is the place where I can carry the original address</xs:documentation>
</xs:annotation>
</xs:attribute>
</xs:extension>
</xs:simpleContent>
</xs:complexType>
<xs:complexType name="HostType">
<xs:annotation>
<xs:documentation>This is a generic host object</xs:documentation>
</xs:annotation>
<xs:sequence>
<xs:element name="HostName" minOccurs="0">
<xs:annotation>
<xs:documentation>Hostname of the server</xs:documentation>
</xs:annotation>
<xs:complexType>
<xs:simpleContent>
<xs:extension base="xs:string">
<xs:attribute name="hostType" type="tns1:MessageType" use="optional">
<xs:annotation>
<xs:documentation>Type of the host such as MQ, JMS, SMTP etc</xs:documentation>
</xs:annotation>
</xs:attribute>
</xs:extension>
</xs:simpleContent>
</xs:complexType>
</xs:element>
<xs:element name="NodeID" type="xs:string" minOccurs="0">
<xs:annotation>
<xs:documentation>Optional NODE ID goes here</xs:documentation>
</xs:annotation>
</xs:element>
<xs:element name="HostIP" type="xs:string" minOccurs="0">
<xs:annotation>
<xs:documentation>Service or host IP address of the service</xs:documentation>
</xs:annotation>
</xs:element>
<xs:element name="HostPort" type="xs:integer" minOccurs="0">
<xs:annotation>
<xs:documentation>Port address of the service</xs:documentation>
</xs:annotation>
</xs:element>
<xs:element name="url" type="xs:string" minOccurs="0">
<xs:annotation>
<xs:documentation>URL address of the service</xs:documentation>
</xs:annotation>
</xs:element>
<xs:element name="HostChannel" type="xs:string" minOccurs="0">
<xs:annotation>
<xs:documentation>Channel name of the service</xs:documentation>
</xs:annotation>
</xs:element>
<xs:element name="ConnectionNumber" type="xs:string" minOccurs="0">
<xs:annotation>
<xs:documentation>the connection number that host is connecttng to.</xs:documentation>
</xs:annotation>
</xs:element>
<xs:element name="CircuitNumber" type="xs:string" minOccurs="0">
<xs:annotation>
<xs:documentation>This is SITA's CNR</xs:documentation>
</xs:annotation>
</xs:element>
<xs:element name="DestinationNumber" type="xs:string" minOccurs="0">
<xs:annotation>
<xs:documentation>This is SITA's DNR</xs:documentation>
</xs:annotation>
</xs:element>
<xs:element name="X25DNA" minOccurs="0" maxOccurs="unbounded">
<xs:annotation>
<xs:documentation>This is SITA's X25 dan numbers</xs:documentation>
</xs:annotation>
<xs:simpleType>
<xs:restriction base="xs:positiveInteger"/>
</xs:simpleType>
</xs:element>
<xs:element name="MessageStatus" type="tns1:MessageStatusType" minOccurs="0" maxOccurs="unbounded">
<xs:annotation>
<xs:documentation>Users can put anything they want here</xs:documentation>
</xs:annotation>
</xs:element>
<xs:element name="MiscData" type="xs:string" minOccurs="0" maxOccurs="unbounded">
<xs:annotation>
<xs:documentation>Users can put anything they want here</xs:documentation>
</xs:annotation>
</xs:element>
<xs:element name="isCustomer" type="xs:boolean">
<xs:annotation>
<xs:documentation>False if the sender/receiver is a SITA system</xs:documentation>
</xs:annotation>
</xs:element>
</xs:sequence>
</xs:complexType>
<xs:complexType name="SitaIdType">
<xs:sequence>
<xs:element name="sitaUID" type="xs:string">
<xs:annotation>
<xs:documentation>The unique ID assigned to the message by the first receiving system. This ID must be contained in the message.</xs:documentation>
</xs:annotation>
</xs:element>
<xs:element name="TransactionID" type="xs:string">
<xs:annotation>
<xs:documentation>An identifier assigned or created for this event. This must be a unique identifier for this message, i.e. the combination of the SitaUID and transaction ID must be unique. This ID must be contained in the message.</xs:documentation>
</xs:annotation>
</xs:element>
</xs:sequence>
</xs:complexType>
</xs:schema> -
In what circumstances would need to use ODI as a complement to a deployment of EDQ?
Im about to do a presentation about Oracle Enterprise Data Quality and Oracle Data Integrator.
In my understanding if I use ODI to do ETL/EL-T tasks, ODI needs EDQ jobs to perform advance Data Quality procesing. In that escenario is perfectly understandable the implementation of both ODI and EDQ solutions.
If I does not have any solution to do ETL/EL-T task, and my objetive is mainly do data cleansing, (take a set of data, cleaning it, and write the results on a database) why I would need ODI? There is a feature that I could need from it, that I do not have in EDQ for this purpose?
This doubt came to me, becouse I found a lot of references that makes me think that this two solutions are codependents.
Thanks for your reply!
regards.Hi,
This might help. Note that ODI and EDQ are normally sold together for Data Warehousing scenarios, though arguably data profiling, at least, is important in nearly all new projects that use ETL/E-LT technology.
Some customers, especially MDM customers, do use EDQ for their ETL requirements, as these tend to be simpler than data warehousing scenarios where load plans and data aggregations are important. ODI also has more comprehensive connectivity than EDQ, for example for Mainframe systems.
We are also seeing a trend for ETL/EL-T to be done strategically in such a way that it rarely needs revisiting for new projects; for example when a new system is onboarded, the key data is replicated or ETL'd into a standard holding area which is then used for any projects which require data from many source systems. This means that EDQ very often takes data output from ETL/EL-T without necessarily being embedded in the ETL or data replication flows.
Very often both ETL and DQ are required
It’s not the size or complexity of the transformation that is different, it’s the nature of the transformations – syntax or meaning?
ODI will do all sorts of denormalisation/normalisation for populating star schemas that would be complex and slow in EDQ
EDQ will do all sorts of things that improve the business value of the data that ODI would never do
Data volumes are unlikely to be a guide as to which toolset would be used for a particular task
Capability
Data Quality tools (e.g. OEDQ)
ETL tools (e.g. ODI)
Extraction of data from common types of modern database / common file types
Yes
Yes
Native extraction of data from antiquated systems using specific APIs, and data from complex file types, e.g. XML, EBCDIC, EDI, IDoc
No
Yes
Complex extraction rules
No
Yes
Syntactic low-level transformations
Yes
Yes
Data profiling
Yes
Basic or none
Semantic understanding of data
Yes
No
Complex transformations using semantic rules
Yes
No
Complex transformations using non-semantic rules (aggregation, analytical, etc.)
Possible, but ETL usually preferred
Yes
Complex matching and merging
Yes
Limited (ETL-type matching/merging) such as exact ID match
Processing as native SQL on database for optimal performance wherever possible
Some
Yes
Advanced performance parallelisation / distribution / control
Rare
Yes
Multiple source/target mapping
Some
Yes
Writing of data to target systems / staging areas / files
Yes
Yes
Advanced load capability, e.g. single/packet/bulk, load plans etc.
Rare
Yes
Typical users
Business Users, Consultants, or IT Professionals
IT Professionals
Regards,
Mike -
Invoking BPEL process using JSP.
HI,
I m trying to invoke my BPEL process using JSP. When tried to invoke, Webpage doesnt display any message.
This is the error, I could collect from log file:
<PAYLOAD>
<MSG_TEXT>ServletException cause</MSG_TEXT>
<SUPPL_DETAIL><![CDATA[com.oracle.bpel.client.delivery.ReceiveTimeOutException: Waiting for response has timed out. The conversation id is null. Please check the process instance for detail.
at com.collaxa.cube.ejb.impl.DeliveryBean.request(DeliveryBean.java:109)
at sun.reflect.GeneratedMethodAccessor96.invoke(Unknown Source)
at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25)
at java.lang.reflect.Method.invoke(Method.java:585)
at com.evermind.server.ejb.interceptor.joinpoint.EJBJoinPointImpl.invoke(EJBJoinPointImpl.java:35)
at com.evermind.server.ejb.interceptor.InvocationContextImpl.proceed(InvocationContextImpl.java:119)
at com.evermind.server.ejb.interceptor.system.DMSInterceptor.invoke(DMSInterceptor.java:52)
at com.evermind.server.ejb.interceptor.InvocationContextImpl.proceed(InvocationContextImpl.java:119)
at com.evermind.server.ejb.interceptor.system.JAASInterceptor$1.run(JAASInterceptor.java:31)
at com.evermind.server.ThreadState.runAs(ThreadState.java:620)
at com.evermind.server.ejb.interceptor.system.JAASInterceptor.invoke(JAASInterceptor.java:34)
at com.evermind.server.ejb.interceptor.InvocationContextImpl.proceed(InvocationContextImpl.java:119)
at com.evermind.server.ejb.interceptor.system.TxRequiredInterceptor.invoke(TxRequiredInterceptor.java:50)
at com.evermind.server.ejb.interceptor.InvocationContextImpl.proceed(InvocationContextImpl.java:119)
at com.evermind.server.ejb.interceptor.system.DMSInterceptor.invoke(DMSInterceptor.java:52)
at com.evermind.server.ejb.interceptor.InvocationContextImpl.proceed(InvocationContextImpl.java:119)
at com.evermind.server.ejb.InvocationContextPool.invoke(InvocationContextPool.java:55)
at com.evermind.server.ejb.StatelessSessionEJBObject.OC4J_invokeMethod(StatelessSessionEJBObject.java:87)
at DeliveryBean_RemoteProxy_4bin6i8.request(Unknown Source)
at com.oracle.bpel.client.delivery.DeliveryService.request(DeliveryService.java:104)
at com.oracle.bpel.client.delivery.DeliveryService.request(DeliveryService.java:53)
at _InvokeDemo__BPEL._jspService(_InvokeDemo__BPEL.java:85)
at com.orionserver.http.OrionHttpJspPage.service(OrionHttpJspPage.java:59)
at oracle.jsp.runtimev2.JspPageTable.service(JspPageTable.java:453)
at oracle.jsp.runtimev2.JspServlet.internalService(JspServlet.java:591)
at oracle.jsp.runtimev2.JspServlet.service(JspServlet.java:515)
at javax.servlet.http.HttpServlet.service(HttpServlet.java:856)
at com.evermind.server.http.ResourceFilterChain.doFilter(ResourceFilterChain.java:64)
at com.collaxa.cube.fe.DomainFilter.doFilter(DomainFilter.java:116)
at com.evermind.server.http.EvermindFilterChain.doFilter(EvermindFilterChain.java:15)
at oracle.security.jazn.oc4j.JAZNFilter$1.run(JAZNFilter.java:396)
at java.security.AccessController.doPrivileged(Native Method)
at javax.security.auth.Subject.doAsPrivileged(Subject.java:517)
at oracle.security.jazn.oc4j.JAZNFilter.doFilter(JAZNFilter.java:410)
at com.evermind.server.http.ServletRequestDispatcher.invoke(ServletRequestDispatcher.java:619)
at com.evermind.server.http.ServletRequestDispatcher.forwardInternal(ServletRequestDispatcher.java:368)
at com.evermind.server.http.HttpRequestHandler.doProcessRequest(HttpRequestHandler.java:866)
at com.evermind.server.http.HttpRequestHandler.processRequest(HttpRequestHandler.java:448)
at com.evermind.server.http.HttpRequestHandler.serveOneRequest(HttpRequestHandler.java:216)
at com.evermind.server.http.HttpRequestHandler.run(HttpRequestHandler.java:117)
at com.evermind.server.http.HttpRequestHandler.run(HttpRequestHandler.java:110)
at oracle.oc4j.network.ServerSocketReadHandler$SafeRunnable.run(ServerSocketReadHandler.java:260)
at oracle.oc4j.network.ServerSocketAcceptHandler.procClientSocket(ServerSocketAcceptHandler.java:239)
at oracle.oc4j.network.ServerSocketAcceptHandler.access$700(ServerSocketAcceptHandler.java:34)
at oracle.oc4j.network.ServerSocketAcceptHandler$AcceptHandlerHorse.run(ServerSocketAcceptHandler.java:880)
at com.evermind.util.ReleasableResourcePooledExecutor$MyWorker.run(ReleasableResourcePooledExecutor.java:303)
at java.lang.Thread.run(Thread.java:595)
Caused by: com.oracle.bpel.client.delivery.ReceiveTimeOutException: Waiting for response has timed out. The conversation id is null. Please check the process instance for detail.
at com.collaxa.cube.engine.delivery.DeliveryHandler.initialRequestAnyType(DeliveryHandler.java:528)
at com.collaxa.cube.engine.delivery.DeliveryHandler.initialRequest(DeliveryHandler.java:451)
at com.collaxa.cube.engine.delivery.DeliveryHandler.request(DeliveryHandler.java:125)
at com.collaxa.cube.ejb.impl.DeliveryBean.request(DeliveryBean.java:95)
... 46 more
]]></SUPPL_DETAIL>
</PAYLOAD>
</MESSAGE>
My BPEL process is a simple process, to get the value from receiver and pass to ouput.
Could someone tell me how to resolve this error....
Thanks in Advance
AjayI am having a similar issue while invoking webservice in ODI I am getting following error. Let me how did you resolve your issue.
com.sunopsis.wsinvocation.SnpsWSInvocationException: com.oracle.bpel.client.delivery.ReceiveTimeOutException: Waiting for response has timed out. The conversation id is null. Please check the process instance for detail.
at com.sunopsis.wsinvocation.client.a.a.d.requestReply(d.java)
at com.sunopsis.graphical.wsclient.f.b(f.java)
at com.sunopsis.graphical.tools.utils.swingworker.v.call(v.java)
at edu.emory.mathcs.backport.java.util.concurrent.FutureTask.run(FutureTask.java:176)
at com.sunopsis.graphical.tools.utils.swingworker.l.run(l.java)
at edu.emory.mathcs.backport.java.util.concurrent.ThreadPoolExecutor$Worker.runTask(ThreadPoolExecutor.java:665)
at edu.emory.mathcs.backport.java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:690)
at java.lang.Thread.run(Unknown Source)
Caused by: com.oracle.bpel.client.delivery.ReceiveTimeOutException: Waiting for response has timed out. The conversation id is null. Please check the process instance for detail.
at org.apache.axis.message.SOAPFaultBuilder.createFault(SOAPFaultBuilder.java:222)
at org.apache.axis.message.SOAPFaultBuilder.endElement(SOAPFaultBuilder.java:129)
at org.apache.axis.encoding.DeserializationContext.endElement(DeserializationContext.java:1087)
at org.apache.crimson.parser.Parser2.maybeElement(Unknown Source)
at org.apache.crimson.parser.Parser2.content(Unknown Source)
at org.apache.crimson.parser.Parser2.maybeElement(Unknown Source)
at org.apache.crimson.parser.Parser2.content(Unknown Source)
at org.apache.crimson.parser.Parser2.maybeElement(Unknown Source)
at org.apache.crimson.parser.Parser2.parseInternal(Unknown Source)
at org.apache.crimson.parser.Parser2.parse(Unknown Source)
at org.apache.crimson.parser.XMLReaderImpl.parse(Unknown Source)
at javax.xml.parsers.SAXParser.parse(Unknown Source)
at org.apache.axis.encoding.DeserializationContext.parse(DeserializationContext.java:227)
at org.apache.axis.SOAPPart.getAsSOAPEnvelope(SOAPPart.java:696)
at org.apache.axis.Message.getSOAPEnvelope(Message.java:435)
at org.apache.axis.handlers.soap.MustUnderstandChecker.invoke(MustUnderstandChecker.java:62)
at org.apache.axis.client.AxisClient.invoke(AxisClient.java:206)
at org.apache.axis.client.Call.invokeEngine(Call.java:2784)
at org.apache.axis.client.Call.invoke(Call.java:2767)
at org.apache.axis.client.Call.invoke(Call.java:1792)
at com.sunopsis.wsinvocation.client.a.a.d.a(d.java)
... 8 more
Caused by:
AxisFault
faultCode: {http://schemas.xmlsoap.org/soap/envelope/}Server
faultSubcode:
faultString: com.oracle.bpel.client.delivery.ReceiveTimeOutException: Waiting for response has timed out. The conversation id is null. Please check the process instance for detail.
faultActor:
faultNode:
faultDetail:
{http://xml.apache.org/axis/}stackTrace:com.oracle.bpel.client.delivery.ReceiveTimeOutException: Waiting for response has timed out. The conversation id is null. Please check the process instance for detail.
at org.apache.axis.message.SOAPFaultBuilder.createFault(SOAPFaultBuilder.java:222)
at org.apache.axis.message.SOAPFaultBuilder.endElement(SOAPFaultBuilder.java:129)
at org.apache.axis.encoding.DeserializationContext.endElement(DeserializationContext.java:1087)
at org.apache.crimson.parser.Parser2.maybeElement(Unknown Source)
at org.apache.crimson.parser.Parser2.content(Unknown Source)
at org.apache.crimson.parser.Parser2.maybeElement(Unknown Source)
at org.apache.crimson.parser.Parser2.content(Unknown Source)
at org.apache.crimson.parser.Parser2.maybeElement(Unknown Source)
at org.apache.crimson.parser.Parser2.parseInternal(Unknown Source)
at org.apache.crimson.parser.Parser2.parse(Unknown Source)
at org.apache.crimson.parser.XMLReaderImpl.parse(Unknown Source)
at javax.xml.parsers.SAXParser.parse(Unknown Source)
at org.apache.axis.encoding.DeserializationContext.parse(DeserializationContext.java:227)
at org.apache.axis.SOAPPart.getAsSOAPEnvelope(SOAPPart.java:696)
at org.apache.axis.Message.getSOAPEnvelope(Message.java:435)
at org.apache.axis.handlers.soap.MustUnderstandChecker.invoke(MustUnderstandChecker.java:62)
at org.apache.axis.client.AxisClient.invoke(AxisClient.java:206)
at org.apache.axis.client.Call.invokeEngine(Call.java:2784)
at org.apache.axis.client.Call.invoke(Call.java:2767)
at org.apache.axis.client.Call.invoke(Call.java:1792)
at com.sunopsis.wsinvocation.client.a.a.d.a(d.java)
at com.sunopsis.wsinvocation.client.a.a.d.requestReply(d.java)
at com.sunopsis.graphical.wsclient.f.b(f.java)
at com.sunopsis.graphical.tools.utils.swingworker.v.call(v.java)
at edu.emory.mathcs.backport.java.util.concurrent.FutureTask.run(FutureTask.java:176)
at com.sunopsis.graphical.tools.utils.swingworker.l.run(l.java)
at edu.emory.mathcs.backport.java.util.concurrent.ThreadPoolExecutor$Worker.runTask(ThreadPoolExecutor.java:665)
at edu.emory.mathcs.backport.java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:690)
at java.lang.Thread.run(Unknown Source)
{http://xml.apache.org/axis/}hostname:sullah-us
com.oracle.bpel.client.delivery.ReceiveTimeOutException: Waiting for response has timed out. The conversation id is null. Please check the process instance for detail.
at org.apache.axis.message.SOAPFaultBuilder.createFault(SOAPFaultBuilder.java:222)
at org.apache.axis.message.SOAPFaultBuilder.endElement(SOAPFaultBuilder.java:129)
at org.apache.axis.encoding.DeserializationContext.endElement(DeserializationContext.java:1087)
at org.apache.crimson.parser.Parser2.maybeElement(Unknown Source)
at org.apache.crimson.parser.Parser2.content(Unknown Source)
at org.apache.crimson.parser.Parser2.maybeElement(Unknown Source)
at org.apache.crimson.parser.Parser2.content(Unknown Source)
at org.apache.crimson.parser.Parser2.maybeElement(Unknown Source)
at org.apache.crimson.parser.Parser2.parseInternal(Unknown Source)
at org.apache.crimson.parser.Parser2.parse(Unknown Source)
at org.apache.crimson.parser.XMLReaderImpl.parse(Unknown Source)
at javax.xml.parsers.SAXParser.parse(Unknown Source)
at org.apache.axis.encoding.DeserializationContext.parse(DeserializationContext.java:227)
at org.apache.axis.SOAPPart.getAsSOAPEnvelope(SOAPPart.java:696)
at org.apache.axis.Message.getSOAPEnvelope(Message.java:435)
at org.apache.axis.handlers.soap.MustUnderstandChecker.invoke(MustUnderstandChecker.java:62)
at org.apache.axis.client.AxisClient.invoke(AxisClient.java:206)
at org.apache.axis.client.Call.invokeEngine(Call.java:2784)
at org.apache.axis.client.Call.invoke(Call.java:2767)
at org.apache.axis.client.Call.invoke(Call.java:1792)
at com.sunopsis.wsinvocation.client.a.a.d.a(d.java)
at com.sunopsis.wsinvocation.client.a.a.d.requestReply(d.java)
at com.sunopsis.graphical.wsclient.f.b(f.java)
at com.sunopsis.graphical.tools.utils.swingworker.v.call(v.java)
at edu.emory.mathcs.backport.java.util.concurrent.FutureTask.run(FutureTask.java:176)
at com.sunopsis.graphical.tools.utils.swingworker.l.run(l.java)
at edu.emory.mathcs.backport.java.util.concurrent.ThreadPoolExecutor$Worker.runTask(ThreadPoolExecutor.java:665)
at edu.emory.mathcs.backport.java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:690)
at java.lang.Thread.run(Unknown Source) -
Error while loading an XML document using a structured application
Hi,
I try to load an XML document using a structured application defined in the default structapps.fm
My code is shown down, extracted from the FDK API code sample.
Problem, I always have the same message :
"Cannot find the file named e:\xml\AdobeFrameMaker10\file. Make sure that the file exists. "
Where "e:\xml\AdobeFrameMaker10\" is my install directory.
So I assume that frame try to find the structapps.fm file but does not find it.
What else can it be ?
Does anyone knowns how to achieve this simple task using extendScript ?
Thanks for any comments, Pierre
function openXMLFile(myLastFile) {
var filename = myLastFile.openDlg("Choose XML file ...", "*.xml", false);
if (filename != null) {
/* Get default open properties. Return if it can’t be allocated. */
var params = GetOpenDefaultParams();
/* Set properties to open an XML document*/
/*Specify XML as file type to open*/
var i = GetPropIndex(params, Constants.FS_OpenAsType)
params[i].propVal.ival = Constants.FV_TYPE_XML;
/* Specify the XML application to be used when opening the document.*/
i = GetPropIndex(params, Constants.FS_StructuredOpenApplication)
params[i].propVal.sval = "myApp";
i = GetPropIndex(params, Constants.FS_FileIsOldVersion)
params[i].propVal.ival = Constants.FV_DoOK
i = GetPropIndex(params, Constants.FS_FontNotFoundInDoc)
params[i].propVal.ival = Constants.FV_DoOK
i = GetPropIndex(params, Constants.FS_FileIsInUse)
params[i].propVal.ival = Constants.FV_DoCancel
i = GetPropIndex(params, Constants.FS_AlertUserAboutFailure)
params[i].propVal.ival = Constants.FV_DoCancel
/*The structapps.fm file containing the specified application must have
already been read. The default structapps.fm file is read when FrameMaker is
opened so this shouldn't be a problem if the application to be used is
listed in the structapps.fm file.*/
var retParm = new PropVals()
var fileObj = Open(filename, params, retParm);
return fileObj
} else {
return null;Pierre,
Depending on the object "myLastFile", the method openDlg might not even exist (if the myLastFile object is not a File object, for instance). And I do not see any need for the myLastFile anyhow, as you are presenting a dialog to select a file to open. I recommend using the global ChooseFile( ) method instead. This will give you a filename as string in full path notation, or null when no file was selected in the dialog. I am not sure what your ExtendScript documentation states about the return value for ChooseFile, but if that differs from what I am telling you here, the documentation is wrong. So, if you replace the first lines of your code with the following it should work:
function openXMLFile ( ) {
var filename = ChooseFile ( "Choose XML file ...", "", "*.xml", Constants.FV_ChooseSelect );
While writing this, I see that Russ has already given you the same advice. Use the symbolic constant value I indicated to use the ChooseFile dialog to select a single file (it can also be used to select a directory or open a file - but you want to control the opening process yourself). Note that this method allows you to set a start directory for the dialog (second parameter). The ESTK autocompletion also gives you a fifth parameter "helplink" which is undocumented and can safely be ignored.
Good luck
Jang -
Unable to load data to Hyperion planning application using odi
Hi All,
When I try to load data into planning using odi, the odi process completes successfully with the following status in the operator ReportStatistics as shown below but the data doesn't seem to appear in the planning data form or essbase
can anyone please help
org.apache.bsf.BSFException: exception from Jython:
Traceback (most recent call last):
File "<string>", line 2, in <module>
Planning Writer Load Summary:
Number of rows successfully processed: 20
Number of rows rejected: 0
source is oracle database
target account dimension
LKM SQL TO SQL
IKM SQL TO HYPERION PLANNING is used
In Target the following columns were mapped
Account(load dimension)
Data load cube name
driverdimensionmetadata
Point of view
LOG FILE
2012-08-27 09:46:43,214 INFO [SimpleAsyncTaskExecutor-3]: Oracle Data Integrator Adapter for Hyperion Planning
2012-08-27 09:46:43,214 INFO [SimpleAsyncTaskExecutor-3]: Connecting to planning application [OPAPP] on [mcg-b055]:[11333] using username [admin].
2012-08-27 09:46:43,277 INFO [SimpleAsyncTaskExecutor-3]: Successfully connected to the planning application.
2012-08-27 09:46:43,277 INFO [SimpleAsyncTaskExecutor-3]: The load options for the planning load are
Dimension Name: Account Sort Parent Child : false
Load Order By Input : false
Refresh Database : false
2012-08-27 09:46:43,339 INFO [SimpleAsyncTaskExecutor-3]: Begining the load process.
2012-08-27 09:46:43,355 DEBUG [SimpleAsyncTaskExecutor-3]: Number of columns in the source result set does not match the number of planning target columns.
2012-08-27 09:46:43,371 INFO [SimpleAsyncTaskExecutor-3]: Load type is [Load dimension member].
2012-08-27 09:46:43,996 INFO [SimpleAsyncTaskExecutor-3]: Load process completed.Do any members exist in the account dimension before the load? if not can you try adding one member manually then trying the load again.
Cheers
John
http://john-goodwin.blogspot.com/ -
Unable to load metada into Hyperion Planning using ODI
HI All,
I am using ODI 11g and trying to load the metadata for Hyperion Planning application 11.1.2.1. But I couldnt load all the Product members in Product Dimension.
Could able to load few members but was able to run the interface successfully but thrown error while loading few members(Most of the members are shared members, verified that base members existed). Please find the below error log.
2011-11-17 06:18:06,534 INFO [SimpleAsyncTaskExecutor-2]: Oracle Data Integrator Adapter for Hyperion Planning
2011-11-17 06:18:06,550 INFO [SimpleAsyncTaskExecutor-2]: Connecting to planning application [xxxx] on [xxxx]:[11333] using username [xxxx].
2011-11-17 06:18:06,675 INFO [SimpleAsyncTaskExecutor-2]: Successfully connected to the planning application.
2011-11-17 06:18:06,706 INFO [SimpleAsyncTaskExecutor-2]: The load options for the planning load are
Dimension Name: Product Sort Parent Child : false
Load Order By Input : false
Refresh Database : false
2011-11-17 06:18:06,768 INFO [SimpleAsyncTaskExecutor-2]: Begining the load process.
2011-11-17 06:18:06,878 DEBUG [SimpleAsyncTaskExecutor-2]: Number of columns in the source result set does not match the number of planning target columns.
2011-11-17 06:18:07,440 INFO [SimpleAsyncTaskExecutor-2]: Load type is [Load dimension member].
2011-11-17 06:18:07,487 ERROR [SimpleAsyncTaskExecutor-2]: Record [[D090, Mobile Mice Cordless_Prod type, D090-Flores DJ, null, Shared, null, null, null, null, null, null, null, +, null]] was rejected by the Planning Server.
2011-11-17 06:18:07,503 ERROR [SimpleAsyncTaskExecutor-2]: Record [[D091, Mobile Mice Cordless_Prod type, D091-Fiji BT, null, Shared, null, null, null, null, null, null, null, +, null]] was rejected by the Planning Server.
2011-11-17 06:18:07,518 ERROR [SimpleAsyncTaskExecutor-2]: Record [[D093, Mobile Mice Cordless_Prod type, D093-New York, null, Shared, null, null, null, null, null, null, null, +, null]] was rejected by the Planning Server.
2011-11-17 06:18:07,550 ERROR [SimpleAsyncTaskExecutor-2]: Record [[D060, Mobile Mice Cordless_Prod type, D060-Corbusier Vista, null, Shared, null, null, null, null, null, null, null, +, null]] was rejected by the Planning Server.
2011-11-17 06:18:07,565 ERROR [SimpleAsyncTaskExecutor-2]: Record [[D064, Mobile Mice Cordless_Prod type, D064-Sardinia Laser, null, Shared, null, null, null, null, null, null, null, +, null]] was rejected by the Planning Server.
2011-11-17 06:18:07,581 ERROR [SimpleAsyncTaskExecutor-2]: Record [[D065, Mobile Mice Cordless_Prod type, D065-Ibiza Optical, null, Shared, null, null, null, null, null, null, null, +, null]] was rejected by the Planning Server.
Regards,
SPCan you check the error log file as you have posted the log file, it should give more information to why the records were rejected.
Cheers
John
http://john-goodwin.blogspot.com/ -
Unable to load Dimension into Hyperion planning using ODI ?
Hi All
We are trying to load Dimension into hyperion planning Ver. 11.1.2 using ODI. We have created the interface and mapped the source csv file to target planmning application using ODI KM.
LKM file to SQL
IKM SQL to Planning
We get success in ODI's Operator but the Dimension is not updated nor new data is insreted.
We get this message in Error file:-
+
Retail Format,Parent,Alias: Default,Data Storage,Two Pass Calculation,Smart List,Data Type,Plan Type (APlan),Error_Reason
ABC,Total Format,,StoreData,,,,Aplan,Cannot load dimension member, error message is: java.lang.RuntimeException: Fetch of saved member "ABC" failed.
+
We get this message in log files:-
+
2010-07-22 07:04:06,550 INFO [DwgCmdExecutionThread]: Oracle Data Integrator Adapter for Hyperion Planning - Release 9.3.1.1
2010-07-22 07:04:06,550 INFO [DwgCmdExecutionThread]: Connecting to planning application [******] on [********]:[11333] using username [admin].
2010-07-22 07:04:06,597 INFO [DwgCmdExecutionThread]: Successfully connected to the planning application.
2010-07-22 07:04:06,597 INFO [DwgCmdExecutionThread]: The load options for the planning load are
Dimension Name: Retail Format Sort Parent Child : false
Load Order By Input : false
Refresh Database : true
2010-07-22 07:04:06,612 INFO [DwgCmdExecutionThread]: Begining the load process.
2010-07-22 07:04:06,612 DEBUG [DwgCmdExecutionThread]: Number of columns in the source result set does not match the number of planning target columns.
2010-07-22 07:04:06,659 INFO [DwgCmdExecutionThread]: Load type is [Load dimension member].
2010-07-22 07:04:06,675 ERROR [DwgCmdExecutionThread]: Record [[ABC, Total Format, null, null, StoreData, null, null, null, null, null, null, null, null, null, Aplan, null, null, null]] was rejected by the Planning Server.
2010-07-22 07:04:06,675 INFO [DwgCmdExecutionThread]: Planing cube refresh operation initiated.
2010-07-22 07:04:08,425 INFO [DwgCmdExecutionThread]: Planning cube refresh operation completed successfully.
2010-07-22 07:04:08,425 INFO [DwgCmdExecutionThread]: Load process completed.
+
Please help out .....Can you check the error log file as you have posted the log file, it should give more information to why the records were rejected.
Cheers
John
http://john-goodwin.blogspot.com/ -
Problem inserting value in CLOB column from an XML file using XSU
Hi,
When I try to insert CLOB value into Oracle9i database from an XML document using XSU, I get an exception as below.
09:37:32,392 ERROR [STDERR] oracle.xml.sql.OracleXMLSQLException: 'java.sql.SQLException: ORA-03237: Initial Extent of specified size cannot be allocated
ORA-06512: at "SYS.DBMS_LOB", line 395
ORA-06512: at line 1
' encountered during processing ROW element 0. All prior XML row changes were rolled back. in the XML document.
All Element tags in XML doc. is mapped to columns in the database. One of the table columns is CLOB. That is the one that gives the above exception. Here is the xml...
ID - is autogenerated value.
<?xml version="1.0" ?>
<ROWSET>
<ROW num="1">
<ID></ID>
<SEQ>
GCATAGTTGTTATGAAGAAATGGAAGAAAAATGCACTCAAAGTTGGGCTGTCAGGCTGTCTGGGGCTGAATTCTGGTGTGACAGTGTGATGAAGCCATCTTTGAGCCTAAATTTGATAATGAGCCAGTCATGATCTGGTTGTGATTACTATAACAAGATTAAATCTGAATAAGAGAGCCACAACTTCTTTAAAGACAGATTGTCAAGTCATTACATGGAAGAGGGAGATTGCTCCTTTGTAAATCAGGCTGTCAGGCCAACTGAATGAAGGACGTCATTGTACAGTAACCTGATGAAGATCAGATCAACCGCTCACCTCGCCG
</SEQ>
</ROW>
</ROWSET>
Can anyone identify what's the problem.. and suggest a solution for this..?
Thanks in advance..
VijiWould you please specify the XDK verison and database version?
Maybe you are looking for
-
Did you try the plugin ARC for Room auto correction ?
Hello everybody, i know it might off topic, but i would like to know if some of you out there use the ARC Room Correction plugin from IK Multimedia, and how is reliable ? I am asking cause i always wonder about my mixes, to people they sound great to
-
How to install Standard Edition One?
I downloaded 10g (10.2.0.1) for Linux x86 and it says it contains Enterprise, Standard and Standard Edition One inside. Once I started installation I had option to install Enterprise or Standard, no option for Standard Edition One. Did I miss somethi
-
Can I use my Blackberry ATT Sim Card with my Ipad 3 - 4G?
I have a Blackberry with an AT&T Data plan. Can I put the Black Berry Sim card in my Ipad 3-4G to access the internet?
-
I run Macbook Pro with Mavericks. I have a licensed copy of Creative Suite CS3 installed. It simply stopped working. InDesign, Photoshop, and Illustrator close upon opening. Tried repairing the installation, uninstalling, and reinstalling. Didn'
-
Why are playlists made in iTunes not pushing to my iPhone, even though I have iTunes Match?
I have made a couple both Smart and regular playlists on iTunes. Then I clicked Store > Update iTunes Match. It updated and yet the playlists are not on my phone... I shouldn't have to sync my phone should I?